| Entry ID | Original Release date | Data summary | Entry Title | Citation Title | Authors |
|---|---|---|---|---|---|
| 53787 | 2026-05-26 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for Nupr1 |
Enhanced large-scale production and purification of recombinant human NUPR1 for detailed structural and functional insights.
|
Donghan Lee, Hae-Kap K Cheong, Jin-Wan W Park, Jong-Soo S Lim, Joonhyeok Choi, Jung-Hye H Ha, Kyoung-Seok S Ryu, Minsu Kim, Sangwook Wu, Woo Sung S Son |
| 52581 | 2026-02-23 | Chemical Shifts: 8 sets |
NOEs of HBpep GY23 with changing pH |
Hierarchical Structural Organization in Bioinspired Peptide Coacervate Microdroplets
|
Ali Miserez, Claire Buchanan, Hannah Boyd, Hiroki Iwase, Jessica Lim, Konstantin Pervushin, Lionel Porcar, Marite Cardenas, Martine Moulin, Quentin M Perrin, Sushanth Gudlur |
| 52549 | 2024-07-18 | Chemical Shifts: 1 set |
Backbone NMR Resonance Assignment for the Wild Type E. coli b-clamp |
The backbone NMR resonance assignments of the stabilized E. coli b-clamp
|
Dmitry M Korzhnev, Irina Bezsonova, Penny J Beuning, Sam Mahdi, Socheata Lim |
| 52548 | 2024-07-18 | Chemical Shifts: 1 set |
Backbone NMR Resonance Assignment for the T45R_S107R E. coli b-clamp |
The backbone NMR resonance assignments of the stabilized E. coli b-clamp
|
Dmitry M Korzhnev, Irina Bezsonova, Penny J Beuning, Sam Mahdi, Socheata Lim |
| 52051 | 2023-09-30 | Chemical Shifts: 1 set |
Backbone resonance assignments for UBE2T |
Backbone 1H, 15N and 13C resonance assignments for an E2 ubiquitin conjugating enzyme-UBE2T
|
CongBao Kang, Hui Qi Q Ng, Qiwei Huang, Wan Hsin H Lim, Yong Yao Y Loh, Zhiyuan Ke |
| 51431 | 2022-07-03 | Chemical Shifts: 1 set |
ILV Methyl NMR Resonance Assignments of the 81 kDa E. coli b-clamp |
ILV methyl NMR resonance assignments of the 81 kDa E. coli beta-clamp
|
Dmitry M Korzhnev, Penny J Beuning, Sam Madhi, Socheata Lim |
| 51430 | 2022-07-03 | Chemical Shifts: 1 set |
ILV Methyl NMR Resonance Assignments of the 81 kDa E. coli b-clamp T45R/S107R |
ILV methyl NMR resonance assignments of the 81 kDa E. coli beta-clamp
|
Dmitry M Korzhnev, Penny J Beuning, Sam Madhi, Socheata Lim |
| 36486 | 2025-10-27 | Chemical Shifts: 1 set |
Structure of Cyclic Rev |
Structure of Cyclic Rev
|
D Kim, R P Barnwal, Y Lim |
| 36464 | 2025-11-04 | Chemical Shifts: 1 set |
PDB structure of RevCC |
Pseudo-Isolated a-Helix Platform for the Recognition of Deep and Narrow Targets.
|
Dong-In I Kim, Euimin Hwang, Hae-Kap K Cheong, Hahnbeom Park, Jung-Yeon Y Ryu, Mandeep Kaur, Ravi P Barnwal, Sehwan Choi, Seong-Jae J Han, So-Hee H Han, Yong-Beom B Lim |
| 51179 | 2021-12-16 | Chemical Shifts: 1 set |
Alpha X I domain NMR backbone assignment |
Heterotropic roles of divalent cations in the establishment of allostery and affinity maturation of integrin aXb2
|
Collins Aboagye, Daniel Lim, James Briggs, James Byrnes, Mehmet Sen, Omar B Abousaway, Pragya Manandhar, Tannon Yu, Zahra Mazhar, Zeinab Moussa |
| 36374 | 2025-10-24 | Chemical Shifts: 1 set |
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1 |
Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.
|
Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim |
| 36375 | 2025-10-24 | Chemical Shifts: 1 set |
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 2 |
Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.
|
Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim |
| 50035 | 2021-06-13 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for dL3D1 |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for dL3D1
|
Chuchu Wang, Chunyu Jia, Chunyu Zhao, Cong Liu, Dan Li, Enquan Xu, Guoqin Feng, Houfang Long, Jin-Jian Hu, Lin Jiang, Mengrong Ma, Renxiao Wang, Shengnan Zhang, Ted M Dawson, Valina L Dawson, Xiaobo Mao, Yan-Mei Li, Yasuyoshi Kimura, Yeh-Jun Lim, Youqi Tao, Yuqing Liu, Zhenying Liu |
| 50034 | 2021-06-13 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for APLP1 E1 domain |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for APLP1 E1 domain
|
Chuchu Wang, Chunyu Jia, Chunyu Zhao, Cong Liu, Dan Li, Enquan Xu, Guoqin Feng, Houfang Long, Jin-Jian Hu, Lin Jiang, Mengrong Ma, Renxiao Wang, Shengnan Zhang, Ted M Dawson, Valina L Dawson, Xiaobo Mao, Yan-Mei Li, Yasuyoshi Kimura, Yeh-Jun Lim, Youqi Tao, Yuqing Liu, Zhenying Liu |
| 27931 | 2020-09-28 | Chemical Shifts: 1 set |
Unfolded ZnF in FUS (371-526) prion-like domain |
A unified mechanism for LLPS of ALS/FTLD-causing FUS as well as its modulation by ATP and oligonucleic acids
|
Jian Kang, Jianxing Song, Liangzhong Lim, Yimei Lu |
| 27932 | 2020-09-28 | Chemical Shifts: 1 set |
Folded ZnF in FUS (371-526) |
A unified mechanism for LLPS of ALS/FTLD-causing FUS as well as its modulation by ATP and oligonucleic acids
|
Jian Kang, Jianxing Song, Liangzhong Lim, Yimei Lu |
| 27914 | 2019-09-20 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for AIMP2 121-320 double-mutant (C205S,C291S) |
Targeting the interaction of AIMP2-DX2 with HSP70 suppresses cancer development
|
Ameeq Ul U Mushtaq, Aneesh Sivaraman, Dae Gyu G Kim, Deepak Bhattarai, Hoi Kyoung K Kim, Hye Young Y Cho, Jihye Lee, Kyeong Lee, Minkyoung Kim, Myung Hee H Kim, Semi Lim, Se-Young Y Son, Sunghoon Kim, Won Suk S Yang, Younah Roh, Young Ho H Jeon, Youngjin Lee |
| 27705 | 2019-01-08 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for Guanylate Cyclase Activating Protein-5 (GCAP5) in Zebrafish Photoreceptors |
Retinal degeneration 3 (RD3) protein, a retinal guanylyl cyclase regulator, forms a monomeric and elongated four helix bundle
|
Alexander M Dizhoor, Diana Cudia, Igor V Peshenko, James B Ames, Qinhong Yu, Sunghyuk Lim |
| 27566 | 2018-11-15 | Chemical Shifts: 1 set |
Backbone assignments of the N domain of bacterial tRNA-(N1G37) methyltransferase (TrmD) |
Backbone resonance assignment for the N-terminal region of bacterial tRNA-(N'1G37) methyltransferase
|
Andreas Larsson, Ann Zhufang Z Koay, CongBao Kang, Hui Qi Q Ng, Jeffrey Hill, Julien Lescar, Peter C Dedon, Qianhui Nah, Siau Hoi H Lim, Wenhe Zhong, Xiaoying Koh-Stenta, Yan Li |
| 27565 | 2018-11-15 | Chemical Shifts: 1 set |
Transmembrane protein 106B (TEM106B) |
TMEM106B, a risk factor for FTLD and aging, has an intrinsically disordered cytoplasmic domain
|
Jian Kang, Jianxing Song, Liang Zhong Lim |
| 27305 | 2018-01-22 | Chemical Shifts: 1 set |
Chemical Shift Assignments of Retinal Degeneration 3 Protein (RD3) |
Chemical shift assignments of retinal degeneration 3 protein (RD3)
|
Alexander M Dizhoor, Diana Cudia, Igor Peshenko, James B Ames, Sunghyuk Lim |
| 36112 | 2018-07-11 | Chemical Shifts: 1 set |
NMR structure of the domain 5 of the E. coli ribosomal protein S1 |
Kinetoplastid membrane protein-11 adopts a four-helix bundle fold in DPC micelle
|
Cynthia Y He, Jianxing Song, Jing Fu, Liang Zhong Z Lim, Shermaine Ee, Yanming Tan |
| 34167 | 2017-09-29 | Chemical Shifts: 1 set Spectral_peak_list: 3 sets |
Solution structure of domain III (DIII)of Zika virus Envelope protein |
A Human Bi-specific Antibody against Zika Virus with High Therapeutic Potential.
|
A Cavalli, A Lanzavecchia, A Rubio, D A Espinosa, D Corti, E Cameroni, E Harris, E Vicenzi, E XY Lim, F Sallusto, F Zatta, G Fibriansah, I Pagani, J Shi, J Wang, K Stettler, L Simonelli, L Varani, M Bardelli, M Beltramello, M Foglierini, M Pedotti, O Zerbe, R Hewson, S Bianchi, S Dowall, S Jaconi, S Jurt, S M Lok, S Pullan, T Barca, T S Ng, V Broccoli, V Graham |
| 26983 | 2017-06-27 | Chemical Shifts: 2 sets Order Parameters: 2 sets |
HBP(D24R)-Histamine-Seratonin methyl and amide order parameters |
Entropy in molecular recognition by proteins
|
A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath |
| 26961 | 2017-02-15 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for SUSP4(201-300) |
The Mechanism of p53 Rescue by SUSP4
|
Chewook Lee, Do-Hyoung H Kim, Eun-Ji J Cha, Ji-Eun E Lim, Joan J Han, Kyou-Hoon H Han, Kyung-Tae T Kim, Seung-Hee H Hong, Si-Hyung H Lee, Ye-Jin J Cho |
| 26888 | 2017-08-11 | Chemical Shifts: 1 set |
Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin in association with heparin analogs |
alpha-Glycosylation by D-glucosamine-derived donors: synthesis of heparosan and heparin analogues that interact with mycobacterial heparin-binding hemagglutinin
|
Chia-Lin Chyan, Chiao-Chu Ku, Chi-Huey Wong, Ching-Jui Huang, Chun-Chih Wang, Deli Irene, Liang-Hin Lim, Medel M Zulueta, Shang-Cheng Hung, Shu-Yi Lin, Susan D Arco, Tsung-I Tsai, Ya-Ting Lin, Yu-Peng Hu, Zhonghao Shi |
| 26887 | 2017-08-11 | Chemical Shifts: 1 set |
Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin |
alpha-Glycosylation by D-glucosamine-derived donors: synthesis of heparosan and heparin analogues that interact with mycobacterial heparin-binding hemagglutinin
|
Chia-Lin Chyan, Chiao-Chu Ku, Chi-Huey Wong, Ching-Jui Huang, Chun-Chih Wang, Deli Irene, Liang-Hin Lim, Medel M Zulueta, Shang-Cheng Hung, Shu-Yi Lin, Susan D Arco, Tsung-I Tsai, Ya-Ting Lin, Yu-Peng Hu, Zhonghao Shi |
| 30161 | 2016-09-09 | Chemical Shifts: 1 set |
Solution structure of response regulator protein from Burkholderia multivorans |
Solution structure of response regulator protein from Burkholderia multivorans
|
F Yang, G Varani, R Barnwal, Y-B Lim |
| 25942 | 2016-12-08 | Chemical Shifts: 1 set |
Full-length WT SOD1 in DPC MICELLE |
SALS-linked WT-SOD1 adopts a highly similar helical conformation as FALS-causing L126Z-SOD1 in a membrane environment
|
Jianxing Song, Liangzhong Lim |
| 25883 | 2015-12-21 | Chemical Shifts: 1 set |
DD homodimer |
Structural basis of death domain signaling in the p75 neurotrophin receptor
|
Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin |
| 26688 | 2015-12-28 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments of Guanylyl Cyclase Activator Protein 1 (GCAP1) mutant V77E in a Ca2+-free/Mg2+-bound Activator State |
Structure of Guanylyl Cyclase Activator Protein 1 (GCAP1) Mutant V77E in a Ca2+-free/Mg2+-bound Activator State
|
Alexander M Dizhoor, Elena V Olshevskaya, Igor V Peshenko, James B Ames, Sunghyuk Lim |
| 25833 | 2015-12-21 | Chemical Shifts: 2 sets |
p75NTR DD:RIP2 CARD |
Structural basis of death domain signaling in the p75 neurotrophin receptor
|
Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin |
| 25829 | 2015-12-21 | Chemical Shifts: 2 sets |
p75NTR DD:RhoGDI |
Structural basis of death domain signaling in the p75 neurotrophin receptor
|
Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin |
| 25828 | 2015-12-21 | Chemical Shifts: 1 set |
RIP2 CARD |
Structural basis of death domain signaling in the p75 neurotrophin receptor
|
Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin |
| 26667 | 2017-06-27 | Order Parameters: 2 sets |
Backbone and side chain order parameters for calcium-bound calmodulin (E84K) |
Entropy in molecular recognition by proteins
|
A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath |
| 26670 | 2017-06-27 | Order Parameters: 3 sets |
order parameters for the CaM(E84K):nNOS(p) complex |
Entropy in molecular recognition by proteins
|
A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath |
| 26648 | 2018-06-27 | Chemical Shifts: 1 set |
FVO Plasmodium falciparum AMA1 |
Solution NMR characterization of apical membrane antigen 1 and small molecule interactions as a basis for designing new antimalarials
|
Bankala Krishnarjuna, Cael O Debono, Christopher A MacRaild, Garima Jaipuria, Hanudatta S Atreya, Hiromasa Yagi, Indu R Chandrashekaran, Martin J Scanlon, Peter J Scammells, Raymond Lam, Raymond S Norton, San Sui S Lim, Shane M Devine |
| 26620 | 2017-06-27 | Chemical Shifts: 1 set Order Parameters: 1 set |
Amide/Methyl/Aromatic chemical shift and order parameter of Barnase-dCGAC |
Entropy in molecular recognition by proteins
|
A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath |
| 26619 | 2017-06-27 | Chemical Shifts: 1 set Order Parameters: 1 set |
Amide/Methyl/Aromatic Chemical Shifts and Order Parameters of Free Barnase |
Entropy in molecular recognition by proteins
|
A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath |
| 25727 | 2017-06-27 | Chemical Shifts: 1 set Order Parameters: 2 sets |
1H, 13C, and 15N Chemical Shift Assignments for Histamine-Binding Protein (D24R) bound to histamine |
Entropy in molecular recognition by proteins
|
A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath |
| 25728 | 2017-06-27 | Chemical Shifts: 1 set Order Parameters: 2 sets |
1H, 13C, and 15N Chemical Shift Assignments for Histamine-Binding Protein (D24R) apo |
Entropy in molecular recognition by proteins
|
A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath |
| 19962 | 2015-05-18 | Chemical Shifts: 1 set |
Truncated L126Z-sod1 in DPC micelle |
Mechanism for transforming cytosolic SOD1 into integral membrane proteins of organelles by ALS-causing mutations
|
Jianxing Song, Liangzhong Lim, Xiaowen Lee |
| 26577 | 2015-12-18 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for Light-adapted Cyanobacteriochrome NpR6012g4 |
1H, 13C, and 15N chemical shift assignments of cyanobacteriochrome NpR6012g4 in the green-absorbing photoproduct state
|
James B Ames, J Clark Lagarias, Nathan C Rockwell, Shelley S Martin, Sunghyuk Lim |
| 25595 | 2015-11-19 | Chemical Shifts: 1 set |
NMR Structure of TDP-43 prion-like hydrophobic helix in DPC |
ALS-causing mutations significantly perturb the self-assembly and interaction with nucleic acid of the intrinsically-disordered prion-like domain of TDP-43
|
Jianxing Song, Liang Zhong Lim |
| 25110 | 2015-02-16 | Chemical Shifts: 1 set |
Solution structure of a left-handed G-quadruplex |
Structure of a left-handed DNA G-quadruplex
|
Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam |
| 19694 | 2014-01-13 | Chemical Shifts: 1 set |
Structure of FHL2 LIM adaptor and its Interaction with Ski |
Structure of FHL2 LIM adaptor and its Interaction with Ski
|
Estela E Medrano, Michael A Weiss, Xiao-Li Yian, Yanwu Yang, Yaqin Sun |
| 19629 | 2014-02-11 | Chemical Shifts: 1 set |
1H, 15N, and 13C Chemical Shift Assignments of the Dark State of a Cyanobacterial GAF Domain (NpF2164-GAF3) |
(1)H, (15)N, and (13)C chemical shift assignments of cyanobacteriochrome NpF2164g3 in the photoproduct state.
|
James B Ames, J Clark Lagarias, Nathan C Rockwell, Shelley S Martin, Sunghyuk Lim |
| 19603 | 2015-04-10 | Chemical Shifts: 1 set |
Solution structures and model membrane interactions of Ctriporin, an Anti-Methicillin-Resistant Staphylococcus aureus peptide from scorpion venom |
Solution structures and model membrane interactions of Ctriporin, an anti-methicillin-resistant Staphylococcus aureus Peptide from Scorpion Venom
|
Brendan Lim, Chiradip Chatterjee, Chong Kok Yee, J Sivaraman, Nicole Yow, R Sanjeev, Ryan Loh Junjie, Sim Ming-Hui Melodies, Susmita Bandyopadhyay, Woon Yong Xin |
| 19597 | 2015-04-10 | Chemical Shifts: 1 set |
Solution structures and model membrane interactions of Ctriporin, an Anti-Methicillin-Resistant Staphylococcus aureus peptide from scorpion venom |
Solution structures and model membrane interactions of Ctriporin, an anti-methicillin-resistant Staphylococcus aureus Peptide from Scorpion Venom
|
Brendan Lim, Chiradip Chatterjee, Chong Kok Yee, J Sivaraman, Nicole Yow, R Sanjeev, Ryan Loh Junjie, Sim Ming-Hui Melodies, Susmita Bandyopadhyay, Woon Yong Xin |
| 19402 | 2013-09-16 | Chemical Shifts: 1 set |
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) |
Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng |
| 19397 | 2014-08-25 | Chemical Shifts: 1 set |
Backbone 1H and 15N Chemical Shift Assignments for the first domain of FAT10 |
Structure of FAT10 first domain
|
Haina Qin, Jianxing Song, Liangzhong Lim, Wei Wang |
| 19281 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19277 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19278 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19276 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[CGCGAAGCATTCGCG] hairpin |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19279 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19280 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19191 | 2013-05-21 | Chemical Shifts: 1 set |
4EBP1 contains a pre-populated eIF4E-binding helix |
4EBP1 contains a pre-populated eIF4E-binding helix
|
Chewook Lee, Christian Griesinger, Do-Hyoung Kim, Donghan Lee, Eun-Ji Cha, Ji-Eun Lim, Kyou-Hoon Han, Si-Hyung Lee, T Michael Sabo, Ye-Jin Cho |
| 19171 | 2014-09-19 | Chemical Shifts: 1 set |
transcriptional repressor domain of methylated DNA binding domain protein 1 |
Transcriptional repressor domain of MBD1 is intrinsically disordered and interacts with its binding partners in a selective manner.
|
Daiwen Yang, Jackwee Lim, Kunchithapadam Swaminathan, Mariusz A Wasik, Qian Zhang, Umar Farook Shahul F Hameed |
| 19150 | 2013-08-15 | Chemical Shifts: 1 set |
1H, 15N, and 13C Chemical Shift Assignments of the Light-activated State of a Cyanobacterial GAF Domain (NpF2164-GAF3) |
(1)H, (15)N, and (13)C chemical shift assignments of cyanobacteriochrome NpF2164g3 in the photoproduct state.
|
James B Ames, J Clark Lagarias, Nathan C Rockwell, Shelley S Martin, Sunghyuk Lim |
| 19146 | 2014-05-05 | Chemical Shifts: 1 set |
Solution structure of RING domain of E3 ubiquitin ligase Doa10 |
Solution structure of RING domain of E3 ubiquitin ligase Doa10
|
Hee-Chul Ahn, Jongsoo Lim, Woo-Sung Son |
| 19080 | 2013-06-04 | Chemical Shifts: 2 sets |
Backbone assignment of an unlinked NS2B and NS3 protease complex of dengue virus 2 |
NMR Analysis of a Novel Enzymatically Active Unlinked Dengue NS2B-NS3 Protease Complex.
|
Alvin W Hung, Andy Yip, Angela Shuyi Chen, Cheng San Brian Chia, Christian G Noble, Congbao Kang, Huichang Annie Lim, Jeffrey Hill, John Liang Kuan Wee, Joma Joy, Le Tian Lee, Melgious Jin Yan Ang, Pei-Yong Shi, Qing-Yin Wang, Qiwei Huang, Rong Li, Shovanlal Gayen, Thomas H Keller, Young Mee Kim |
| 19057 | 2014-09-19 | Chemical Shifts: 1 set |
brevinin-2-related peptide, an antimicrobial peptide derived from frog skin |
Micelle bound structure and DNA interaction of brevinin-2-related peptide, an antimicrobial peptide derived from frog skin.
|
Boon Yee Y Ng, Charmaine Chong, Chiradip Chatterjee, J Sivaraman, Ke Hui H Lee, Ming Zhen Z Lim, Sonia Kiran K Gill, Susmita Bandyopadhyay |
| 18934 | 2014-03-31 | Chemical Shifts: 1 set |
Binary complex of African Swine Fever Virus Pol X with MgdGTP |
How a low-fidelity DNA polymerase chooses non-watson-crick from watson-crick incorporation.
|
Chun-Wei Eric Wang, Frank HT Nelissen, Jian-Li Wu, Jurgen F Doreleijers, Liang-Hin Lim, Mei-I Su, Ming-Chuan Chad Chen, Ming-Daw Tsai, Sandeep Kumar, Sybren S Wijmenga, Wen-Jin Wu |
| 18933 | 2014-03-31 | Chemical Shifts: 1 set |
ASFV Pol X structure |
How a low-fidelity DNA polymerase chooses non-watson-crick from watson-crick incorporation.
|
Chun-Wei Eric Wang, Frank HT Nelissen, Jian-Li Wu, Jurgen F Doreleijers, Liang-Hin Lim, Mei-I Su, Ming-Chuan Chad Chen, Ming-Daw Tsai, Sandeep Kumar, Sybren S Wijmenga, Wen-Jin Wu |
| 18935 | 2014-03-31 | Chemical Shifts: 1 set |
African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA |
How a low-fidelity DNA polymerase chooses non-watson-crick from watson-crick incorporation.
|
Chun-Wei Eric Wang, Frank HT Nelissen, Jian-Li Wu, Jurgen F Doreleijers, Liang-Hin Lim, Mei-I Su, Ming-Chuan Chad Chen, Ming-Daw Tsai, Sandeep Kumar, Sybren S Wijmenga, Wen-Jin Wu |
| 18915 | 2019-08-30 | Chemical Shifts: 1 set Spectral_peak_list: 1 set |
Brevenin DPC micelle bound structure |
Micelle bound structure and DNA interaction of brevinin-2-related peptide, an antimicrobial peptide derived from frog skin
|
Boon Yee Y Ng, Charmaine Chong, Chiradip Chatterjee, J Sivaraman, Ke Hui H Lee, Ming Zhen Z Lim, Sonia Kiran K Gill, Susmita Bandyopadhyay |
| 18730 | 2013-02-12 | Chemical Shifts: 1 set |
Chemical shift assignment of West Nile Virus NS2B-NS3 protease in a complex with 4-phenyl-phenyl-KKR-aldehyde. |
Exploring the binding of peptidic West Nile virus NS2B-NS3 protease inhibitors by NMR.
|
Anders Poulsen, Andreas Schuller, Angela Shuyi Chen, Cheng San Brian Chia, Congbao Kang, Danny Ngoc Phouc Doan, Huichang Annie Lim, Jeffrey Hill, Rene Severin, Shovanlal Gayen, Subhash G Vasudevan, Thomas H Keller, Weiling Wang |
| 18613 | 2013-07-22 | Chemical Shifts: 1 set |
NMR solution structure of Eph receptor |
Protein dynamics at Eph receptor-ligand interfaces as revealed by crystallography, NMR and MD simulations.
|
Haina Qin, Jianxing Song, Liangzhong Lim |
| 18540 | 2013-04-02 | Chemical Shifts: 1 set |
NMR solution structure of midkine-a |
Structure-function analysis of full-length midkine reveals novel residues important for heparin binding and zebrafish embryogenesis.
|
Christoph Winkler, Daiwen Yang, Jackwee Lim, Martin Graf, Sheng Yao |
| 18541 | 2013-04-02 | Chemical Shifts: 1 set |
NMR solution structure of midkine-b, mdkb |
Structure-function analysis of full-length midkine reveals novel residues important for heparin binding and zebrafish embryogenesis.
|
Christoph Winkler, Daiwen Yang, Jackwee Lim, Martin Graf, Sheng Yao |
| 18443 | 2012-06-05 | Chemical Shifts: 1 set |
Solution structure of a thioredoxin from Thermus thermophilus |
Solution structure of a thioredoxin from Thermus thermophilus
|
A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim |
| 18432 | 2013-04-02 | Chemical Shifts: 1 set |
Solution structure of polymerase-interacting domain of human Rev1 in complex with translesional synthesis polymerase kappa |
Insights into the regulation of human Rev1 for translesion synthesis polymerases revealed by the structural studies on its polymerase-interacting domain.
|
Byong-Seok Choi, Dawei Sun, Dinan Liu, Jie-Oh Lee, Jung Me Hwang, Junsang Ko, Kyoung-Seok Ryu, Kyungeun Lim, Zee-Won Lee |
| 18415 | 2012-05-22 | Chemical Shifts: 1 set |
Solution structure of human C-type lectin domain family 4 member D |
Solution structure of human C-type lectin domain family 4 member D
|
A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Gaudette, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim |
| 18411 | 2012-05-22 | Chemical Shifts: 1 set |
Solution structure of a putative protein disulfide isomerase from Bacteroides thetaiotaomicron |
Solution structure of a putative protein disulfide isomerase from Bacteroides thetaiotaomicron
|
A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim |
| 18394 | 2012-04-24 | Chemical Shifts: 1 set |
Solution structure of the uncharacterized thioredoxin-like protein BVU_1432 from Bacteroides vulgatus |
Solution structure of the uncharacterized thioredoxin-like protein BVU_1432 from Bacteroides vulgatus
|
A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim |
| 18387 | 2012-05-21 | Chemical Shifts: 1 set |
Solution structure of a thiol:disulfide interchange protein from Bacteroides sp. |
Solution structure of a thiol:disulfide interchange protein from Bacteroides sp.
|
A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim |
| 18026 | 2012-03-09 | Chemical Shifts: 1 set |
Backbone Chemical Shift Assignments for Unmyristoylated GCAP1 bound to Ca2+ ions |
Backbone (1)H, (13)C, and (15)N resonance assignments of guanylyl cyclase activating protein-1, GCAP1.
|
Alexander M Dizhoor, Igor V Peshenko, James B Ames, Sunghyuk Lim |
| 17697 | 2011-08-19 | Chemical Shifts: 1 set |
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface |
Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do |
| 17432 | 2012-01-09 | Chemical Shifts: 1 set |
Solution structure of murine myristoylated msrA |
Characterization and solution structure of mouse myristoylated methionine sulfoxide reductase A.
|
Bart Ghesquiere, Geumsoo Kim, Grzegorz Piszczek, James M Gruschus, Jung Chae Lim, Nico Tjandra, Rodney L Levine |
| 17355 | 2012-07-25 | Chemical Shifts: 1 set |
NMR solution structure of meACP |
Solution structures of the acyl carrier protein domain from the highly reducing type I iterative polyketide synthase CalE8
|
Daiwen Yang, Elavazhagan Murugan, Jack Wee Lim, Kong Rong, Lawrence CL Ho, Zhao-Xun Liang |
| 11350 | 2011-09-07 | Chemical Shifts: 1 set |
Solution structure of LIM domain in Four and a half LIM domains protein 2 |
Solution structure of LIM domain in Four and a half LIM domains protein 2
|
F He, M Inoue, M Shirouzu, S Yokoyama, T Kigawa, T Terada, Y Muto |
| 11349 | 2011-09-07 | Chemical Shifts: 1 set |
Solution structure of LIM domain in LIM-protein 3 |
Solution structure of LIM domain in LIM-protein 3
|
F He, M Inoue, M Shirouzu, S Yokoyama, T Kigawa, T Terada, Y Muto |
| 11305 | 2011-08-19 | Chemical Shifts: 1 set |
Solution Structure of the LIM Domain of the Human Actin Binding LIM Protein 2 |
Solution Structure of the LIM Domain of the Human Actin Binding LIM Protein 2
|
K Miyamoto, M Inoue, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa |
| 11289 | 2011-08-18 | Chemical Shifts: 1 set |
Solution structure of the LIM domain of human Leupaxin |
Solution structure of the LIM domain of human Leupaxin
|
M Inoue, M Yoneyama, N Tochio, S Koshiba, S Yokoyama, T Kigawa |
| 11293 | 2011-08-19 | Chemical Shifts: 1 set |
Solution structure of the LIM domain of human Cysteine-rich protein 2 |
Solution structure of the LIM domain of human Cysteine-rich protein 2
|
A Sasagawa, M Inoue, M Yoneyama, N Tochio, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa |
| 11248 | 2011-08-03 | Chemical Shifts: 1 set |
Solution structure of the PDZ domain from mouse LIM domain kinase |
Solution structure of the PDZ domain from mouse LIM domain kinase
|
F Hayashi, S Yokoyama, T Suetake |
| 17065 | 2010-10-14 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Binary Tandem Ubiquitin Binding Domains of Signal Transducing Adapter Molecule 1 |
Backbone (1)H, (13)C, and (15)N assignments for the tandem ubiquitin binding domains of signal transducing adapter molecule 1.
|
Bong-Jin Lee, Hee-Chul Ahn, Jongsoo Lim, Yoon-Hun Hong |
| 17059 | 2010-09-08 | Binding_constants: 1 set |
Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy |
Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy
|
Bong-Jin Lee, Eun Y Park, Hee-Chul Ahn, Hong-Man Kim, Hye-Young Ji, Hyun K Song, Ji-Hun Kim, Jongsoo Lim, Seunga Lee, Yoon-Hun Hong |
| 16763 | 2010-03-24 | Binding_constants: 1 set |
Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy |
Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy
|
Bong-Jin Lee, Eun Y Park, Hee-Chul Ahn, Hong-Man Kim, Hye-Young Ji, Hyun K Song, Ji-Hun Kim, Jongsoo Lim, Seunga Lee, Yoon-Hun Hong |
| 11085 | 2011-01-04 | Chemical Shifts: 1 set |
Solution structure of the CH domain of human NEDD9 interacting protein with calponin homology and LIM domains |
Solution structure of the CH domain of human NEDD9 interacting protein with calponin homology and LIM domains
|
M Inoue, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa |
| 16446 | 2009-11-19 | Chemical Shifts: 1 set |
Chemical shift assignments for Ncs1p |
(1)H, (15)N, and (13)C chemical shift assignments of neuronal calcium sensor-1 homolog from fission yeast.
|
James B Ames, Sunghyuk Lim |
| 16359 | 2009-12-16 | Chemical Shifts: 1 set |
chemical shift assignment of West Nile protease in the absence of inhibitor |
NMR analysis of the dynamic exchange of the NS2B cofactor between open and closed conformations of the West Nile virus NS2B-NS3 protease.
|
Gottfried Otting, Kiyoshi Ozawa, Ruhu Qi, Siew P Lim, Subhash G Vasudevan, Xun-Cheng Su |
| 16259 | 2009-12-11 | Chemical Shifts: 2 sets |
Beta7 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments |
Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation.
|
Camilla L Oxley, Chinten J Lim, Iain D Campbell, Jacob R Haling, Kate L Wegener, Mark H Ginsberg, Massimiliano Memo, Nicholas J Anthis |
| 16063 | 2009-04-16 | Chemical Shifts: 1 set |
Solution structure of ILK/PINCH complex |
Structural Basis of Focal Adhesion Localization of LIM-only Adaptor PINCH by Integrin-linked Kinase
|
Cheryl A Hawkins, Chuanyue Wu, Jinbu Wang, Julia Vaynberg, Jun Qin, Kan Chen, Nico Tjandra, Xian Mao, Xiaobing Zuo, Xiaoxia Wang, Yanwu Yang, Yizeng Tu, Yun-xing Wang |
| 10247 | 2009-11-03 | Chemical Shifts: 1 set |
Solution structures of the LIM domain of human NEDD9 interacting protein with calponin homology and LIM domains |
Solution structures of the LIM domain of human NEDD9 interacting protein with calponin homology and LIM domains
|
K Saito, M Inoue, M Sato, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa |
| 11053 | 2009-07-14 | Chemical Shifts: 1 set |
Chemical shifts assignment for the West Nile virus NS2B(K96A)-NS3 protease |
NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease
|
Amedeo Caflisch, Danzhi Huang, Dariusz Ekonomiuk, Daying Wen, Gottfried Otting, Hiromasa Yagi, Kiyoshi Ozawa, Sebastian Sonntag, Siew P Lim, Subhash G Vasudevan, Thomas H Keller, Xun-Cheng Su |
| 6658 | 2005-12-14 | Chemical Shifts: 1 set |
NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex |
1H, 15N and 13C Assignments of an Intramolecular Lhx3:ldb1 Complex
|
Amy L Nancarrow, Christopher Lee, Ingolf Bach, Jacqueline M Matthews, Joel P Mackay |
| 10069 | 2008-08-14 | Chemical Shifts: 1 set |
Solution structure of the Villin headpiece domain of human actin-binding LIM protein homologue (KIAA0843 protein) |
Solution structure of the Villin headpiece domain of human actin-binding LIM protein homologue (KIAA0843 protein)
|
N Tochio, S Koshiba, S Yokoyama, T Kigawa |
| 15059 | 2007-06-26 | Chemical Shifts: 1 set |
1H, 13C, and 15N Chemical Shift Assignments for the muscular LIM protein MLP/CRP3. |
1H, 13C, and 15N assignment of the muscular LIM protein MLP/CRP3
|
Christian Edlich, Claudia Muhle-Goll, Gunter Stier, Thomas Schallus |
| 15020 | 2007-05-04 | Chemical Shifts: 1 set |
Structure of the N-WASP EVH1 domain in complex with an extended WIP peptide |
Multiple WASP-interacting protein recognition motifs are required for a functional interaction with N-WASP
|
B F Volkman, F C Peterson, K E Prehoda, M Way, M Zettl, Q Deng, W A Lim |
| 7312 | 2009-10-20 | Chemical Shifts: 1 set |
1H,13C and 15N resonance assignment of the VHS domain of human STAM1 protein |
Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy
|
Bong-Jin Lee, Eun-Young Park, Hee-Chul Ahn, Hong-Man Kim, Hye-Young Ji, Hyun-Kyu Song, Ji-Hun Kim, Jongsoo Lim, Seunga Lee, Yoon-Hun Hong |
| 6218 | 2005-02-08 | Coupling Constants: 1 set |
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs |
Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs
|
K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim |
| 6217 | 2005-02-08 | Coupling Constants: 1 set |
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs |
Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs
|
K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim |
| 6219 | Unknown | Chemical Shifts: 1 set |
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs |
Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs
|
K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim |
| 6220 | Unknown | Chemical Shifts: 1 set |
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs |
Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs
|
K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim |
| 6092 | 2011-08-11 | Chemical Shifts: 1 set Heteronuclear NOE Values: 1 set T1 Relaxation Values: 1 set T2 Relaxation Values: 1 set |
1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of RIL (reversion induced LIM) |
A closed binding pocket and global destabilization modify the binding properties of an alternatively spliced form of the second PDZ domain of PTP-BL
|
Geerten W Vuister, J Aelen, L van den Berk, M Oostendorp, S B Nabuurs, Tine Walma, W Hendriks |
| 5554 | 2003-02-21 | Chemical Shifts: 1 set |
Structure of the N-WASP EVH1 Domain-WIP complex |
Structure of the N-WASP EVH1 Domain-WIP Complex: Insight into the Molecular Basis of Wiskott-Aldrich Syndrome
|
B F Volkman, F C Peterson, J A Scott, K E Prehoda, W A Lim |
| 5524 | 2003-01-14 | Chemical Shifts: 1 set |
Resonance Assignment and Topology of a Clostridial Repetitive Oligopeptide (CROP) Region of Toxin A from Clostridium Difficile |
Letter to the Editor: Resonance Assignment and Topology of a Clostridial Repetitive Oligopeptide (CROP) Region of Toxin A from Clostridium difficile
|
Jenson Lim, Mathieu Rappas, Neil Fairweather, Peter Simpson, Stephen Matthews, Sunil Prasannan |
| 5065 | 2001-11-14 | Chemical Shifts: 1 set |
Quail Cysteine and Glycine-rich Protein, NMR, 15 Minimized Model Structures |
Application of Cross-correlated NMR Spin Relaxation to the Zinc-finger Protein CRP2(LIM2): Evidence for Collective Motions in LIM Domains
|
Karin Kloiber, Klaus Bister, Robert Konrat, Theresia Matt, Wolfgang Schuler |
| 4884 | 2001-03-12 | Chemical Shifts: 1 set |
1st LIM domain of PINCH protein |
Solution Structure of Focal Adhesion Adaptor PINCH LIM1 Domain and Characterization of Its Interaction with Integrin Linked Kinase Ankyrin Repeat Domain
|
Algirdas Velyvis, Chuanyue Wu, Jun Qin, Yanwu Yang |