Instant search results.

110 results found. These results are sorted by relevance. You can sort the results by clicking on the table headers.

Download citations for all displayed entries in BibTeX format
Entry ID Original Release date Data summary Entry Title Citation Title Authors
52581 2026-02-23 Chemical Shifts: 8 sets
NOEs of HBpep GY23 with changing pH Hierarchical Structural Organization in Bioinspired Peptide Coacervate Microdroplets Download bibtex for citation iamge Ali Miserez, Claire Buchanan, Hannah Boyd, Hiroki Iwase, Jessica Lim, Konstantin Pervushin, Lionel Porcar, Marite Cardenas, Martine Moulin, Quentin M Perrin, Sushanth Gudlur
52549 2024-07-18 Chemical Shifts: 1 set
Backbone NMR Resonance Assignment for the Wild Type E. coli b-clamp The backbone NMR resonance assignments of the stabilized E. coli b-clamp Download bibtex for citation iamge Dmitry M Korzhnev, Irina Bezsonova, Penny J Beuning, Sam Mahdi, Socheata Lim
52548 2024-07-18 Chemical Shifts: 1 set
Backbone NMR Resonance Assignment for the T45R_S107R E. coli b-clamp The backbone NMR resonance assignments of the stabilized E. coli b-clamp Download bibtex for citation iamge Dmitry M Korzhnev, Irina Bezsonova, Penny J Beuning, Sam Mahdi, Socheata Lim
52051 2023-09-30 Chemical Shifts: 1 set
Backbone resonance assignments for UBE2T Backbone 1H, 15N and 13C resonance assignments for an E2 ubiquitin conjugating enzyme-UBE2T Download bibtex for citation iamge CongBao Kang, Hui Qi Q Ng, Qiwei Huang, Wan Hsin H Lim, Yong Yao Y Loh, Zhiyuan Ke
51430 2022-07-03 Chemical Shifts: 1 set
ILV Methyl NMR Resonance Assignments of the 81 kDa E. coli b-clamp T45R/S107R ILV methyl NMR resonance assignments of the 81 kDa E. coli beta-clamp Download bibtex for citation iamge Dmitry M Korzhnev, Penny J Beuning, Sam Madhi, Socheata Lim
51431 2022-07-03 Chemical Shifts: 1 set
ILV Methyl NMR Resonance Assignments of the 81 kDa E. coli b-clamp ILV methyl NMR resonance assignments of the 81 kDa E. coli beta-clamp Download bibtex for citation iamge Dmitry M Korzhnev, Penny J Beuning, Sam Madhi, Socheata Lim
36486 2025-10-27 Chemical Shifts: 1 set
Structure of Cyclic Rev Structure of Cyclic Rev Download bibtex for citation iamge D Kim, R P Barnwal, Y Lim
36464 2025-11-04 Chemical Shifts: 1 set
PDB structure of RevCC Pseudo-Isolated a-Helix Platform for the Recognition of Deep and Narrow Targets. Download bibtex for citation iamge Dong-In I Kim, Euimin Hwang, Hae-Kap K Cheong, Hahnbeom Park, Jung-Yeon Y Ryu, Mandeep Kaur, Ravi P Barnwal, Sehwan Choi, Seong-Jae J Han, So-Hee H Han, Yong-Beom B Lim
51179 2021-12-16 Chemical Shifts: 1 set
Alpha X I domain NMR backbone assignment Heterotropic roles of divalent cations in the establishment of allostery and affinity maturation of integrin aXb2 Download bibtex for citation iamge Collins Aboagye, Daniel Lim, James Briggs, James Byrnes, Mehmet Sen, Omar B Abousaway, Pragya Manandhar, Tannon Yu, Zahra Mazhar, Zeinab Moussa
36375 2025-10-24 Chemical Shifts: 1 set
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 2 Coexistence of two quadruplex-duplex hybrids in the PIM1 gene. Download bibtex for citation iamge Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim
36374 2025-10-24 Chemical Shifts: 1 set
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1 Coexistence of two quadruplex-duplex hybrids in the PIM1 gene. Download bibtex for citation iamge Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim
50035 2021-06-13 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for dL3D1 Backbone 1H, 13C, and 15N Chemical Shift Assignments for dL3D1 Download bibtex for citation iamge Chuchu Wang, Chunyu Jia, Chunyu Zhao, Cong Liu, Dan Li, Enquan Xu, Guoqin Feng, Houfang Long, Jin-Jian Hu, Lin Jiang, Mengrong Ma, Renxiao Wang, Shengnan Zhang, Ted M Dawson, Valina L Dawson, Xiaobo Mao, Yan-Mei Li, Yasuyoshi Kimura, Yeh-Jun Lim, Youqi Tao, Yuqing Liu, Zhenying Liu
50034 2021-06-13 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for APLP1 E1 domain Backbone 1H, 13C, and 15N Chemical Shift Assignments for APLP1 E1 domain Download bibtex for citation iamge Chuchu Wang, Chunyu Jia, Chunyu Zhao, Cong Liu, Dan Li, Enquan Xu, Guoqin Feng, Houfang Long, Jin-Jian Hu, Lin Jiang, Mengrong Ma, Renxiao Wang, Shengnan Zhang, Ted M Dawson, Valina L Dawson, Xiaobo Mao, Yan-Mei Li, Yasuyoshi Kimura, Yeh-Jun Lim, Youqi Tao, Yuqing Liu, Zhenying Liu
27931 2020-09-28 Chemical Shifts: 1 set
Unfolded ZnF in FUS (371-526) prion-like domain A unified mechanism for LLPS of ALS/FTLD-causing FUS as well as its modulation by ATP and oligonucleic acids Download bibtex for citation iamge Jian Kang, Jianxing Song, Liangzhong Lim, Yimei Lu
27932 2020-09-28 Chemical Shifts: 1 set
Folded ZnF in FUS (371-526) A unified mechanism for LLPS of ALS/FTLD-causing FUS as well as its modulation by ATP and oligonucleic acids Download bibtex for citation iamge Jian Kang, Jianxing Song, Liangzhong Lim, Yimei Lu
27914 2019-09-20 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for AIMP2 121-320 double-mutant (C205S,C291S) Targeting the interaction of AIMP2-DX2 with HSP70 suppresses cancer development Download bibtex for citation iamge Ameeq Ul U Mushtaq, Aneesh Sivaraman, Dae Gyu G Kim, Deepak Bhattarai, Hoi Kyoung K Kim, Hye Young Y Cho, Jihye Lee, Kyeong Lee, Minkyoung Kim, Myung Hee H Kim, Semi Lim, Se-Young Y Son, Sunghoon Kim, Won Suk S Yang, Younah Roh, Young Ho H Jeon, Youngjin Lee
27705 2019-01-08 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for Guanylate Cyclase Activating Protein-5 (GCAP5) in Zebrafish Photoreceptors Retinal degeneration 3 (RD3) protein, a retinal guanylyl cyclase regulator, forms a monomeric and elongated four helix bundle Download bibtex for citation iamge Alexander M Dizhoor, Diana Cudia, Igor V Peshenko, James B Ames, Qinhong Yu, Sunghyuk Lim
27566 2018-11-15 Chemical Shifts: 1 set
Backbone assignments of the N domain of bacterial tRNA-(N1G37) methyltransferase (TrmD) Backbone resonance assignment for the N-terminal region of bacterial tRNA-(N'1G37) methyltransferase Download bibtex for citation iamge Andreas Larsson, Ann Zhufang Z Koay, CongBao Kang, Hui Qi Q Ng, Jeffrey Hill, Julien Lescar, Peter C Dedon, Qianhui Nah, Siau Hoi H Lim, Wenhe Zhong, Xiaoying Koh-Stenta, Yan Li
27565 2018-11-15 Chemical Shifts: 1 set
Transmembrane protein 106B (TEM106B) TMEM106B, a risk factor for FTLD and aging, has an intrinsically disordered cytoplasmic domain Download bibtex for citation iamge Jian Kang, Jianxing Song, Liang Zhong Lim
27305 2018-01-22 Chemical Shifts: 1 set
Chemical Shift Assignments of Retinal Degeneration 3 Protein (RD3) Chemical shift assignments of retinal degeneration 3 protein (RD3) Download bibtex for citation iamge Alexander M Dizhoor, Diana Cudia, Igor Peshenko, James B Ames, Sunghyuk Lim
36112 2018-07-11 Chemical Shifts: 1 set
NMR structure of the domain 5 of the E. coli ribosomal protein S1 Kinetoplastid membrane protein-11 adopts a four-helix bundle fold in DPC micelle Download bibtex for citation iamge Cynthia Y He, Jianxing Song, Jing Fu, Liang Zhong Z Lim, Shermaine Ee, Yanming Tan
34167 2017-09-29 Chemical Shifts: 1 set
Spectral_peak_list: 3 sets
Solution structure of domain III (DIII)of Zika virus Envelope protein A Human Bi-specific Antibody against Zika Virus with High Therapeutic Potential. Download bibtex for citation iamge A Cavalli, A Lanzavecchia, A Rubio, D A Espinosa, D Corti, E Cameroni, E Harris, E Vicenzi, E XY Lim, F Sallusto, F Zatta, G Fibriansah, I Pagani, J Shi, J Wang, K Stettler, L Simonelli, L Varani, M Bardelli, M Beltramello, M Foglierini, M Pedotti, O Zerbe, R Hewson, S Bianchi, S Dowall, S Jaconi, S Jurt, S M Lok, S Pullan, T Barca, T S Ng, V Broccoli, V Graham
26983 2017-06-27 Chemical Shifts: 2 sets
Order Parameters: 2 sets
HBP(D24R)-Histamine-Seratonin methyl and amide order parameters Entropy in molecular recognition by proteins Download bibtex for citation iamge A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath
26961 2017-02-15 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for SUSP4(201-300) The Mechanism of p53 Rescue by SUSP4 Download bibtex for citation iamge Chewook Lee, Do-Hyoung H Kim, Eun-Ji J Cha, Ji-Eun E Lim, Joan J Han, Kyou-Hoon H Han, Kyung-Tae T Kim, Seung-Hee H Hong, Si-Hyung H Lee, Ye-Jin J Cho
26888 2017-08-11 Chemical Shifts: 1 set
Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin in association with heparin analogs alpha-Glycosylation by D-glucosamine-derived donors: synthesis of heparosan and heparin analogues that interact with mycobacterial heparin-binding hemagglutinin Download bibtex for citation iamge Chia-Lin Chyan, Chiao-Chu Ku, Chi-Huey Wong, Ching-Jui Huang, Chun-Chih Wang, Deli Irene, Liang-Hin Lim, Medel M Zulueta, Shang-Cheng Hung, Shu-Yi Lin, Susan D Arco, Tsung-I Tsai, Ya-Ting Lin, Yu-Peng Hu, Zhonghao Shi
26887 2017-08-11 Chemical Shifts: 1 set
Complete 1H 13C 15N chemical shift assignments of Mycobacterial Heparin-Binding Hemagglutinin alpha-Glycosylation by D-glucosamine-derived donors: synthesis of heparosan and heparin analogues that interact with mycobacterial heparin-binding hemagglutinin Download bibtex for citation iamge Chia-Lin Chyan, Chiao-Chu Ku, Chi-Huey Wong, Ching-Jui Huang, Chun-Chih Wang, Deli Irene, Liang-Hin Lim, Medel M Zulueta, Shang-Cheng Hung, Shu-Yi Lin, Susan D Arco, Tsung-I Tsai, Ya-Ting Lin, Yu-Peng Hu, Zhonghao Shi
30161 2016-09-09 Chemical Shifts: 1 set
Solution structure of response regulator protein from Burkholderia multivorans Solution structure of response regulator protein from Burkholderia multivorans Download bibtex for citation iamge F Yang, G Varani, R Barnwal, Y-B Lim
25942 2016-12-08 Chemical Shifts: 1 set
Full-length WT SOD1 in DPC MICELLE SALS-linked WT-SOD1 adopts a highly similar helical conformation as FALS-causing L126Z-SOD1 in a membrane environment Download bibtex for citation iamge Jianxing Song, Liangzhong Lim
25883 2015-12-21 Chemical Shifts: 1 set
DD homodimer Structural basis of death domain signaling in the p75 neurotrophin receptor Download bibtex for citation iamge Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin
26688 2015-12-28 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments of Guanylyl Cyclase Activator Protein 1 (GCAP1) mutant V77E in a Ca2+-free/Mg2+-bound Activator State Structure of Guanylyl Cyclase Activator Protein 1 (GCAP1) Mutant V77E in a Ca2+-free/Mg2+-bound Activator State Download bibtex for citation iamge Alexander M Dizhoor, Elena V Olshevskaya, Igor V Peshenko, James B Ames, Sunghyuk Lim
25833 2015-12-21 Chemical Shifts: 2 sets
p75NTR DD:RIP2 CARD Structural basis of death domain signaling in the p75 neurotrophin receptor Download bibtex for citation iamge Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin
25829 2015-12-21 Chemical Shifts: 2 sets
p75NTR DD:RhoGDI Structural basis of death domain signaling in the p75 neurotrophin receptor Download bibtex for citation iamge Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin
25828 2015-12-21 Chemical Shifts: 1 set
RIP2 CARD Structural basis of death domain signaling in the p75 neurotrophin receptor Download bibtex for citation iamge Carlos F Ibanez, Claire Kelly, Eddy TH Goh, Jason Y Tann, Jian F Gao, Kim B Lim, Zhi Lin
26667 2017-06-27 Order Parameters: 2 sets
Backbone and side chain order parameters for calcium-bound calmodulin (E84K) Entropy in molecular recognition by proteins Download bibtex for citation iamge A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath
26670 2017-06-27 Order Parameters: 3 sets
order parameters for the CaM(E84K):nNOS(p) complex Entropy in molecular recognition by proteins Download bibtex for citation iamge A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath
26648 2018-06-27 Chemical Shifts: 1 set
FVO Plasmodium falciparum AMA1 Solution NMR characterization of apical membrane antigen 1 and small molecule interactions as a basis for designing new antimalarials Download bibtex for citation iamge Bankala Krishnarjuna, Cael O Debono, Christopher A MacRaild, Garima Jaipuria, Hanudatta S Atreya, Hiromasa Yagi, Indu R Chandrashekaran, Martin J Scanlon, Peter J Scammells, Raymond Lam, Raymond S Norton, San Sui S Lim, Shane M Devine
26620 2017-06-27 Chemical Shifts: 1 set
Order Parameters: 1 set
Amide/Methyl/Aromatic chemical shift and order parameter of Barnase-dCGAC Entropy in molecular recognition by proteins Download bibtex for citation iamge A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath
26619 2017-06-27 Chemical Shifts: 1 set
Order Parameters: 1 set
Amide/Methyl/Aromatic Chemical Shifts and Order Parameters of Free Barnase Entropy in molecular recognition by proteins Download bibtex for citation iamge A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath
25728 2017-06-27 Chemical Shifts: 1 set
Order Parameters: 2 sets
1H, 13C, and 15N Chemical Shift Assignments for Histamine-Binding Protein (D24R) apo Entropy in molecular recognition by proteins Download bibtex for citation iamge A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath
25727 2017-06-27 Chemical Shifts: 1 set
Order Parameters: 2 sets
1H, 13C, and 15N Chemical Shift Assignments for Histamine-Binding Protein (D24R) bound to histamine Entropy in molecular recognition by proteins Download bibtex for citation iamge A Joshua J Wand, Jackwee Lim, Jeffrey Granja, Jose A Caro, Kathleen G Valentine, Kim A Sharp, Kyle W Harpole, Vignesh Kasinath
19962 2015-05-18 Chemical Shifts: 1 set
Truncated L126Z-sod1 in DPC micelle Mechanism for transforming cytosolic SOD1 into integral membrane proteins of organelles by ALS-causing mutations Download bibtex for citation iamge Jianxing Song, Liangzhong Lim, Xiaowen Lee
26577 2015-12-18 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for Light-adapted Cyanobacteriochrome NpR6012g4 1H, 13C, and 15N chemical shift assignments of cyanobacteriochrome NpR6012g4 in the green-absorbing photoproduct state Download bibtex for citation iamge James B Ames, J Clark Lagarias, Nathan C Rockwell, Shelley S Martin, Sunghyuk Lim
25595 2015-11-19 Chemical Shifts: 1 set
NMR Structure of TDP-43 prion-like hydrophobic helix in DPC ALS-causing mutations significantly perturb the self-assembly and interaction with nucleic acid of the intrinsically-disordered prion-like domain of TDP-43 Download bibtex for citation iamge Jianxing Song, Liang Zhong Lim
25110 2015-02-16 Chemical Shifts: 1 set
Solution structure of a left-handed G-quadruplex Structure of a left-handed DNA G-quadruplex Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam
19694 2014-01-13 Chemical Shifts: 1 set
Structure of FHL2 LIM adaptor and its Interaction with Ski Structure of FHL2 LIM adaptor and its Interaction with Ski Download bibtex for citation iamge Estela E Medrano, Michael A Weiss, Xiao-Li Yian, Yanwu Yang, Yaqin Sun
19629 2014-02-11 Chemical Shifts: 1 set
1H, 15N, and 13C Chemical Shift Assignments of the Dark State of a Cyanobacterial GAF Domain (NpF2164-GAF3) (1)H, (15)N, and (13)C chemical shift assignments of cyanobacteriochrome NpF2164g3 in the photoproduct state. Download bibtex for citation iamge James B Ames, J Clark Lagarias, Nathan C Rockwell, Shelley S Martin, Sunghyuk Lim
19603 2015-04-10 Chemical Shifts: 1 set
Solution structures and model membrane interactions of Ctriporin, an Anti-Methicillin-Resistant Staphylococcus aureus peptide from scorpion venom Solution structures and model membrane interactions of Ctriporin, an anti-methicillin-resistant Staphylococcus aureus Peptide from Scorpion Venom Download bibtex for citation iamge Brendan Lim, Chiradip Chatterjee, Chong Kok Yee, J Sivaraman, Nicole Yow, R Sanjeev, Ryan Loh Junjie, Sim Ming-Hui Melodies, Susmita Bandyopadhyay, Woon Yong Xin
19597 2015-04-10 Chemical Shifts: 1 set
Solution structures and model membrane interactions of Ctriporin, an Anti-Methicillin-Resistant Staphylococcus aureus peptide from scorpion venom Solution structures and model membrane interactions of Ctriporin, an anti-methicillin-resistant Staphylococcus aureus Peptide from Scorpion Venom Download bibtex for citation iamge Brendan Lim, Chiradip Chatterjee, Chong Kok Yee, J Sivaraman, Nicole Yow, R Sanjeev, Ryan Loh Junjie, Sim Ming-Hui Melodies, Susmita Bandyopadhyay, Woon Yong Xin
19402 2013-09-16 Chemical Shifts: 1 set
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng
19397 2014-08-25 Chemical Shifts: 1 set
Backbone 1H and 15N Chemical Shift Assignments for the first domain of FAT10 Structure of FAT10 first domain Download bibtex for citation iamge Haina Qin, Jianxing Song, Liangzhong Lim, Wei Wang
19281 2013-07-08 Chemical Shifts: 1 set
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19277 2013-07-08 Chemical Shifts: 1 set
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19278 2013-07-08 Chemical Shifts: 1 set
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19276 2013-07-08 Chemical Shifts: 1 set
Structure of d[CGCGAAGCATTCGCG] hairpin Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19280 2013-07-08 Chemical Shifts: 1 set
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19279 2013-07-08 Chemical Shifts: 1 set
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19191 2013-05-21 Chemical Shifts: 1 set
4EBP1 contains a pre-populated eIF4E-binding helix 4EBP1 contains a pre-populated eIF4E-binding helix Download bibtex for citation iamge Chewook Lee, Christian Griesinger, Do-Hyoung Kim, Donghan Lee, Eun-Ji Cha, Ji-Eun Lim, Kyou-Hoon Han, Si-Hyung Lee, T Michael Sabo, Ye-Jin Cho
19171 2014-09-19 Chemical Shifts: 1 set
transcriptional repressor domain of methylated DNA binding domain protein 1 Transcriptional repressor domain of MBD1 is intrinsically disordered and interacts with its binding partners in a selective manner. Download bibtex for citation iamge Daiwen Yang, Jackwee Lim, Kunchithapadam Swaminathan, Mariusz A Wasik, Qian Zhang, Umar Farook Shahul F Hameed
19150 2013-08-15 Chemical Shifts: 1 set
1H, 15N, and 13C Chemical Shift Assignments of the Light-activated State of a Cyanobacterial GAF Domain (NpF2164-GAF3) (1)H, (15)N, and (13)C chemical shift assignments of cyanobacteriochrome NpF2164g3 in the photoproduct state. Download bibtex for citation iamge James B Ames, J Clark Lagarias, Nathan C Rockwell, Shelley S Martin, Sunghyuk Lim
19146 2014-05-05 Chemical Shifts: 1 set
Solution structure of RING domain of E3 ubiquitin ligase Doa10 Solution structure of RING domain of E3 ubiquitin ligase Doa10 Download bibtex for citation iamge Hee-Chul Ahn, Jongsoo Lim, Woo-Sung Son
19080 2013-06-04 Chemical Shifts: 2 sets
Backbone assignment of an unlinked NS2B and NS3 protease complex of dengue virus 2 NMR Analysis of a Novel Enzymatically Active Unlinked Dengue NS2B-NS3 Protease Complex. Download bibtex for citation iamge Alvin W Hung, Andy Yip, Angela Shuyi Chen, Cheng San Brian Chia, Christian G Noble, Congbao Kang, Huichang Annie Lim, Jeffrey Hill, John Liang Kuan Wee, Joma Joy, Le Tian Lee, Melgious Jin Yan Ang, Pei-Yong Shi, Qing-Yin Wang, Qiwei Huang, Rong Li, Shovanlal Gayen, Thomas H Keller, Young Mee Kim
19057 2014-09-19 Chemical Shifts: 1 set
brevinin-2-related peptide, an antimicrobial peptide derived from frog skin Micelle bound structure and DNA interaction of brevinin-2-related peptide, an antimicrobial peptide derived from frog skin. Download bibtex for citation iamge Boon Yee Y Ng, Charmaine Chong, Chiradip Chatterjee, J Sivaraman, Ke Hui H Lee, Ming Zhen Z Lim, Sonia Kiran K Gill, Susmita Bandyopadhyay
18934 2014-03-31 Chemical Shifts: 1 set
Binary complex of African Swine Fever Virus Pol X with MgdGTP How a low-fidelity DNA polymerase chooses non-watson-crick from watson-crick incorporation. Download bibtex for citation iamge Chun-Wei Eric Wang, Frank HT Nelissen, Jian-Li Wu, Jurgen F Doreleijers, Liang-Hin Lim, Mei-I Su, Ming-Chuan Chad Chen, Ming-Daw Tsai, Sandeep Kumar, Sybren S Wijmenga, Wen-Jin Wu
18935 2014-03-31 Chemical Shifts: 1 set
African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA How a low-fidelity DNA polymerase chooses non-watson-crick from watson-crick incorporation. Download bibtex for citation iamge Chun-Wei Eric Wang, Frank HT Nelissen, Jian-Li Wu, Jurgen F Doreleijers, Liang-Hin Lim, Mei-I Su, Ming-Chuan Chad Chen, Ming-Daw Tsai, Sandeep Kumar, Sybren S Wijmenga, Wen-Jin Wu
18933 2014-03-31 Chemical Shifts: 1 set
ASFV Pol X structure How a low-fidelity DNA polymerase chooses non-watson-crick from watson-crick incorporation. Download bibtex for citation iamge Chun-Wei Eric Wang, Frank HT Nelissen, Jian-Li Wu, Jurgen F Doreleijers, Liang-Hin Lim, Mei-I Su, Ming-Chuan Chad Chen, Ming-Daw Tsai, Sandeep Kumar, Sybren S Wijmenga, Wen-Jin Wu
18915 2019-08-30 Chemical Shifts: 1 set
Spectral_peak_list: 1 set
Brevenin DPC micelle bound structure Micelle bound structure and DNA interaction of brevinin-2-related peptide, an antimicrobial peptide derived from frog skin Download bibtex for citation iamge Boon Yee Y Ng, Charmaine Chong, Chiradip Chatterjee, J Sivaraman, Ke Hui H Lee, Ming Zhen Z Lim, Sonia Kiran K Gill, Susmita Bandyopadhyay
18730 2013-02-12 Chemical Shifts: 1 set
Chemical shift assignment of West Nile Virus NS2B-NS3 protease in a complex with 4-phenyl-phenyl-KKR-aldehyde. Exploring the binding of peptidic West Nile virus NS2B-NS3 protease inhibitors by NMR. Download bibtex for citation iamge Anders Poulsen, Andreas Schuller, Angela Shuyi Chen, Cheng San Brian Chia, Congbao Kang, Danny Ngoc Phouc Doan, Huichang Annie Lim, Jeffrey Hill, Rene Severin, Shovanlal Gayen, Subhash G Vasudevan, Thomas H Keller, Weiling Wang
18613 2013-07-22 Chemical Shifts: 1 set
NMR solution structure of Eph receptor Protein dynamics at Eph receptor-ligand interfaces as revealed by crystallography, NMR and MD simulations. Download bibtex for citation iamge Haina Qin, Jianxing Song, Liangzhong Lim
18541 2013-04-02 Chemical Shifts: 1 set
NMR solution structure of midkine-b, mdkb Structure-function analysis of full-length midkine reveals novel residues important for heparin binding and zebrafish embryogenesis. Download bibtex for citation iamge Christoph Winkler, Daiwen Yang, Jackwee Lim, Martin Graf, Sheng Yao
18540 2013-04-02 Chemical Shifts: 1 set
NMR solution structure of midkine-a Structure-function analysis of full-length midkine reveals novel residues important for heparin binding and zebrafish embryogenesis. Download bibtex for citation iamge Christoph Winkler, Daiwen Yang, Jackwee Lim, Martin Graf, Sheng Yao
18443 2012-06-05 Chemical Shifts: 1 set
Solution structure of a thioredoxin from Thermus thermophilus Solution structure of a thioredoxin from Thermus thermophilus Download bibtex for citation iamge A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim
18432 2013-04-02 Chemical Shifts: 1 set
Solution structure of polymerase-interacting domain of human Rev1 in complex with translesional synthesis polymerase kappa Insights into the regulation of human Rev1 for translesion synthesis polymerases revealed by the structural studies on its polymerase-interacting domain. Download bibtex for citation iamge Byong-Seok Choi, Dawei Sun, Dinan Liu, Jie-Oh Lee, Jung Me Hwang, Junsang Ko, Kyoung-Seok Ryu, Kyungeun Lim, Zee-Won Lee
18415 2012-05-22 Chemical Shifts: 1 set
Solution structure of human C-type lectin domain family 4 member D Solution structure of human C-type lectin domain family 4 member D Download bibtex for citation iamge A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Gaudette, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim
18411 2012-05-22 Chemical Shifts: 1 set
Solution structure of a putative protein disulfide isomerase from Bacteroides thetaiotaomicron Solution structure of a putative protein disulfide isomerase from Bacteroides thetaiotaomicron Download bibtex for citation iamge A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim
18394 2012-04-24 Chemical Shifts: 1 set
Solution structure of the uncharacterized thioredoxin-like protein BVU_1432 from Bacteroides vulgatus Solution structure of the uncharacterized thioredoxin-like protein BVU_1432 from Bacteroides vulgatus Download bibtex for citation iamge A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim
18387 2012-05-21 Chemical Shifts: 1 set
Solution structure of a thiol:disulfide interchange protein from Bacteroides sp. Solution structure of a thiol:disulfide interchange protein from Bacteroides sp. Download bibtex for citation iamge A Celikgil, A D Bandaranayake, A Gizzi, A Kar, B Evans, B Hillerich, B Matikainen, B Smith, D A Calarese, H Patel, J B Bonanno, J Lafleur, J Love, M E Girvin, M K Chan, M Stead, R Banu, R Chaparro, R D Seidel, R Harris, S C Almo, S Chamala, S Garforth, S Lim
18026 2012-03-09 Chemical Shifts: 1 set
Backbone Chemical Shift Assignments for Unmyristoylated GCAP1 bound to Ca2+ ions Backbone (1)H, (13)C, and (15)N resonance assignments of guanylyl cyclase activating protein-1, GCAP1. Download bibtex for citation iamge Alexander M Dizhoor, Igor V Peshenko, James B Ames, Sunghyuk Lim
17697 2011-08-19 Chemical Shifts: 1 set
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do
17432 2012-01-09 Chemical Shifts: 1 set
Solution structure of murine myristoylated msrA Characterization and solution structure of mouse myristoylated methionine sulfoxide reductase A. Download bibtex for citation iamge Bart Ghesquiere, Geumsoo Kim, Grzegorz Piszczek, James M Gruschus, Jung Chae Lim, Nico Tjandra, Rodney L Levine
17355 2012-07-25 Chemical Shifts: 1 set
NMR solution structure of meACP Solution structures of the acyl carrier protein domain from the highly reducing type I iterative polyketide synthase CalE8 Download bibtex for citation iamge Daiwen Yang, Elavazhagan Murugan, Jack Wee Lim, Kong Rong, Lawrence CL Ho, Zhao-Xun Liang
11350 2011-09-07 Chemical Shifts: 1 set
Solution structure of LIM domain in Four and a half LIM domains protein 2 Solution structure of LIM domain in Four and a half LIM domains protein 2 Download bibtex for citation iamge F He, M Inoue, M Shirouzu, S Yokoyama, T Kigawa, T Terada, Y Muto
11349 2011-09-07 Chemical Shifts: 1 set
Solution structure of LIM domain in LIM-protein 3 Solution structure of LIM domain in LIM-protein 3 Download bibtex for citation iamge F He, M Inoue, M Shirouzu, S Yokoyama, T Kigawa, T Terada, Y Muto
11305 2011-08-19 Chemical Shifts: 1 set
Solution Structure of the LIM Domain of the Human Actin Binding LIM Protein 2 Solution Structure of the LIM Domain of the Human Actin Binding LIM Protein 2 Download bibtex for citation iamge K Miyamoto, M Inoue, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa
11293 2011-08-19 Chemical Shifts: 1 set
Solution structure of the LIM domain of human Cysteine-rich protein 2 Solution structure of the LIM domain of human Cysteine-rich protein 2 Download bibtex for citation iamge A Sasagawa, M Inoue, M Yoneyama, N Tochio, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa
11289 2011-08-18 Chemical Shifts: 1 set
Solution structure of the LIM domain of human Leupaxin Solution structure of the LIM domain of human Leupaxin Download bibtex for citation iamge M Inoue, M Yoneyama, N Tochio, S Koshiba, S Yokoyama, T Kigawa
11248 2011-08-03 Chemical Shifts: 1 set
Solution structure of the PDZ domain from mouse LIM domain kinase Solution structure of the PDZ domain from mouse LIM domain kinase Download bibtex for citation iamge F Hayashi, S Yokoyama, T Suetake
17065 2010-10-14 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the Binary Tandem Ubiquitin Binding Domains of Signal Transducing Adapter Molecule 1 Backbone (1)H, (13)C, and (15)N assignments for the tandem ubiquitin binding domains of signal transducing adapter molecule 1. Download bibtex for citation iamge Bong-Jin Lee, Hee-Chul Ahn, Jongsoo Lim, Yoon-Hun Hong
17059 2010-09-08 Binding_constants: 1 set
Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy Download bibtex for citation iamge Bong-Jin Lee, Eun Y Park, Hee-Chul Ahn, Hong-Man Kim, Hye-Young Ji, Hyun K Song, Ji-Hun Kim, Jongsoo Lim, Seunga Lee, Yoon-Hun Hong
16763 2010-03-24 Binding_constants: 1 set
Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy Download bibtex for citation iamge Bong-Jin Lee, Eun Y Park, Hee-Chul Ahn, Hong-Man Kim, Hye-Young Ji, Hyun K Song, Ji-Hun Kim, Jongsoo Lim, Seunga Lee, Yoon-Hun Hong
11085 2011-01-04 Chemical Shifts: 1 set
Solution structure of the CH domain of human NEDD9 interacting protein with calponin homology and LIM domains Solution structure of the CH domain of human NEDD9 interacting protein with calponin homology and LIM domains Download bibtex for citation iamge M Inoue, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa
16446 2009-11-19 Chemical Shifts: 1 set
Chemical shift assignments for Ncs1p (1)H, (15)N, and (13)C chemical shift assignments of neuronal calcium sensor-1 homolog from fission yeast. Download bibtex for citation iamge James B Ames, Sunghyuk Lim
16359 2009-12-16 Chemical Shifts: 1 set
chemical shift assignment of West Nile protease in the absence of inhibitor NMR analysis of the dynamic exchange of the NS2B cofactor between open and closed conformations of the West Nile virus NS2B-NS3 protease. Download bibtex for citation iamge Gottfried Otting, Kiyoshi Ozawa, Ruhu Qi, Siew P Lim, Subhash G Vasudevan, Xun-Cheng Su
16259 2009-12-11 Chemical Shifts: 2 sets
Beta7 Integrin Cytoplasmic Tail 1H and 15N Chemical Shift Assignments Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. Download bibtex for citation iamge Camilla L Oxley, Chinten J Lim, Iain D Campbell, Jacob R Haling, Kate L Wegener, Mark H Ginsberg, Massimiliano Memo, Nicholas J Anthis
16063 2009-04-16 Chemical Shifts: 1 set
Solution structure of ILK/PINCH complex Structural Basis of Focal Adhesion Localization of LIM-only Adaptor PINCH by Integrin-linked Kinase Download bibtex for citation iamge Cheryl A Hawkins, Chuanyue Wu, Jinbu Wang, Julia Vaynberg, Jun Qin, Kan Chen, Nico Tjandra, Xian Mao, Xiaobing Zuo, Xiaoxia Wang, Yanwu Yang, Yizeng Tu, Yun-xing Wang
10247 2009-11-03 Chemical Shifts: 1 set
Solution structures of the LIM domain of human NEDD9 interacting protein with calponin homology and LIM domains Solution structures of the LIM domain of human NEDD9 interacting protein with calponin homology and LIM domains Download bibtex for citation iamge K Saito, M Inoue, M Sato, S Koshiba, S Yokoyama, T Kigawa, T Tomizawa
11053 2009-07-14 Chemical Shifts: 1 set
Chemical shifts assignment for the West Nile virus NS2B(K96A)-NS3 protease NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease Download bibtex for citation iamge Amedeo Caflisch, Danzhi Huang, Dariusz Ekonomiuk, Daying Wen, Gottfried Otting, Hiromasa Yagi, Kiyoshi Ozawa, Sebastian Sonntag, Siew P Lim, Subhash G Vasudevan, Thomas H Keller, Xun-Cheng Su
6658 2005-12-14 Chemical Shifts: 1 set
NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex 1H, 15N and 13C Assignments of an Intramolecular Lhx3:ldb1 Complex Download bibtex for citation iamge Amy L Nancarrow, Christopher Lee, Ingolf Bach, Jacqueline M Matthews, Joel P Mackay
10069 2008-08-14 Chemical Shifts: 1 set
Solution structure of the Villin headpiece domain of human actin-binding LIM protein homologue (KIAA0843 protein) Solution structure of the Villin headpiece domain of human actin-binding LIM protein homologue (KIAA0843 protein) Download bibtex for citation iamge N Tochio, S Koshiba, S Yokoyama, T Kigawa
15059 2007-06-26 Chemical Shifts: 1 set
1H, 13C, and 15N Chemical Shift Assignments for the muscular LIM protein MLP/CRP3. 1H, 13C, and 15N assignment of the muscular LIM protein MLP/CRP3 Download bibtex for citation iamge Christian Edlich, Claudia Muhle-Goll, Gunter Stier, Thomas Schallus
15020 2007-05-04 Chemical Shifts: 1 set
Structure of the N-WASP EVH1 domain in complex with an extended WIP peptide Multiple WASP-interacting protein recognition motifs are required for a functional interaction with N-WASP Download bibtex for citation iamge B F Volkman, F C Peterson, K E Prehoda, M Way, M Zettl, Q Deng, W A Lim
7312 2009-10-20 Chemical Shifts: 1 set
1H,13C and 15N resonance assignment of the VHS domain of human STAM1 protein Identification of a novel ubiquitin binding site of STAM1 VHS domain by NMR spectroscopy Download bibtex for citation iamge Bong-Jin Lee, Eun-Young Park, Hee-Chul Ahn, Hong-Man Kim, Hye-Young Ji, Hyun-Kyu Song, Ji-Hun Kim, Jongsoo Lim, Seunga Lee, Yoon-Hun Hong
6217 2005-02-08 Coupling Constants: 1 set
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Download bibtex for citation iamge K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim
6218 2005-02-08 Coupling Constants: 1 set
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Download bibtex for citation iamge K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim
6219 Unknown Chemical Shifts: 1 set
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Download bibtex for citation iamge K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim
6220 Unknown Chemical Shifts: 1 set
Antibiotic Activity and Structural Analysis of a Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Antibiotic Activity and Structural Analysis of the Scorpion-derived Antimicrobial peptide IsCT and Its Analogs Download bibtex for citation iamge K Kim, K Lee, K S Hahm, S S Lim, S Y Shin, Y Kim
6092 2011-08-11 Chemical Shifts: 1 set
Heteronuclear NOE Values: 1 set
T1 Relaxation Values: 1 set
T2 Relaxation Values: 1 set
1H, 13C, and 15N Chemical Shift Assignments for a complex of PDZ2 from PTP-BL with the C-terminus of RIL (reversion induced LIM) A closed binding pocket and global destabilization modify the binding properties of an alternatively spliced form of the second PDZ domain of PTP-BL Download bibtex for citation iamge Geerten W Vuister, J Aelen, L van den Berk, M Oostendorp, S B Nabuurs, Tine Walma, W Hendriks
5554 2003-02-21 Chemical Shifts: 1 set
Structure of the N-WASP EVH1 Domain-WIP complex Structure of the N-WASP EVH1 Domain-WIP Complex: Insight into the Molecular Basis of Wiskott-Aldrich Syndrome Download bibtex for citation iamge B F Volkman, F C Peterson, J A Scott, K E Prehoda, W A Lim
5524 2003-01-14 Chemical Shifts: 1 set
Resonance Assignment and Topology of a Clostridial Repetitive Oligopeptide (CROP) Region of Toxin A from Clostridium Difficile Letter to the Editor: Resonance Assignment and Topology of a Clostridial Repetitive Oligopeptide (CROP) Region of Toxin A from Clostridium difficile Download bibtex for citation iamge Jenson Lim, Mathieu Rappas, Neil Fairweather, Peter Simpson, Stephen Matthews, Sunil Prasannan
5065 2001-11-14 Chemical Shifts: 1 set
Quail Cysteine and Glycine-rich Protein, NMR, 15 Minimized Model Structures Application of Cross-correlated NMR Spin Relaxation to the Zinc-finger Protein CRP2(LIM2): Evidence for Collective Motions in LIM Domains Download bibtex for citation iamge Karin Kloiber, Klaus Bister, Robert Konrat, Theresia Matt, Wolfgang Schuler
4884 2001-03-12 Chemical Shifts: 1 set
1st LIM domain of PINCH protein Solution Structure of Focal Adhesion Adaptor PINCH LIM1 Domain and Characterization of Its Interaction with Integrin Linked Kinase Ankyrin Repeat Domain Download bibtex for citation iamge Algirdas Velyvis, Chuanyue Wu, Jun Qin, Yanwu Yang