| Entry ID | Original Release date | Data summary | Entry Title | Citation Title | Authors |
|---|---|---|---|---|---|
| 51692 | 2023-06-27 | Chemical Shifts: 1 set |
Sidechain Ile, Leu, and Val methyl Chemical Shift Assignments for Penicillin Binding Protein 5 |
Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5
|
Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal |
| 51690 | 2023-06-27 | Chemical Shifts: 1 set |
Sequence Specific 1H, 13C, and 15N backbone resonance assignments of 70 kDa Penicillin Binding Protein PBP5 |
Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5
|
Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal |
| 51654 | 2022-10-10 | Chemical Shifts: 1 set |
Backbone N and HN Chemical Shift Assignments for RBPMS-A (1-122) |
Phosphorylation of the smooth muscle master splicing regulator RBPMS regulates its splicing activity
|
Christopher Smith, Clare Gooding, Erick E Nakagaki-Silva, Katherine Stott, Mariavittoria Pizzinga, Michael D Barnhart, Thomas H Hammond, Yi Yang |
| 50938 | 2022-05-11 | Chemical Shifts: 2 sets |
Natural Teixobactin - Lipid II complex |
Teixobactin kills bacteria by a two-pronged attack on the cell envelope
|
Aaron J Peoples, Adela Melcrova, Alexandre Bonvin, Amy L Spoering, Bram Vermeulen, Chelsea R Jones, Dallas E Hughes, Eefjan Breukink, Francesca Lavore, Harold D MacGillavry, James S Nowick, Joao Medeiros-Silva, Joseph H Lorent, Kim Lewis, Lea Marie M Becker, Losee L Ling, Maik Derks, Markus Weingarth, Michael A Morris, Moreno Lelli, Raj Kumar, Rhythm Shukla, Roy van Beekveld, Sourav Maity, Wouter H Roos, Xiaoqi Wang |
| 30717 | 2020-11-27 | Chemical Shifts: 1 set Spectral_peak_list: 1 set |
Hs05 - Intragenic antimicrobial peptide |
Characterization of novel human intragenic antimicrobial peptides, incorporation and release studies from ureasil-polyether hybrid matrix
|
A L Oliveira, A R Araujo, B Lira, C Bloch, E A Barbosa, E M Carmo da Silva, G D Brand, G H Mariano, J A Chaker, J L Cardozo Fh, J Leite, L G Gomes de Sa, M A Santos, M Ramada |
| 30716 | 2021-01-24 | Chemical Shifts: 1 set |
Stigmurin |
NMR three-dimensional structure of the cationic peptide Stigmurin from Tityus stigmurus scorpion venom: In vitro antioxidant and in vivo antibacterial and healing activity
|
A D Silva, A D Silva-Junior, E CG Santos, H Rocha, J M Resende, M FF Pedrosa, M FQ Neto, R M Araujo, S CS Rodrigues |
| 30586 | 2020-04-13 | Chemical Shifts: 1 set |
Syn-safencin |
Synthetic Antimicrobial Peptide Tuning Permits Membrane Disruption and Interpeptide Synergy
|
A James J Mason, Albert Siryaporn, Alejandro J Gonzalez, Charlotte K Hind, Francisco R Fields, Francis J Castellino, Giorgia Manzo, Henry M Vu, Ilona P Foik, Jeshina Janardhanan, Jessica N Ross, J Mark M Sutton, Mayland Chang, Melanie Clifford, Phoebe Do D Carmo Silva, Rashna D Balsara, Shaun Lee, Tam T Bui, Veronica R Kalwajtys, Victoria A Ploplis |
| 30588 | 2020-05-11 | Chemical Shifts: 1 set |
Syn-safencin 56 |
Synthetic Antimicrobial Peptide Tuning Permits Membrane Disruption and Interpeptide Synergy
|
A James J Mason, Albert Siryaporn, Alejandro J Gonzalez, Charlotte K Hind, Francisco R Fields, Francis J Castellino, Giorgia Manzo, Henry M Vu, Ilona P Foik, Jeshina Janardhanan, Jessica N Ross, J Mark M Sutton, Mayland Chang, Melanie Clifford, Phoebe Do D Carmo Silva, Rashna D Balsara, Shaun Lee, Tam T Bui, Veronica R Kalwajtys, Victoria A Ploplis |
| 30587 | 2020-05-11 | Chemical Shifts: 1 set |
Syn-safencin 24 |
Synthetic Antimicrobial Peptide Tuning Permits Membrane Disruption and Interpeptide Synergy
|
A James J Mason, Albert Siryaporn, Alejandro J Gonzalez, Charlotte K Hind, Francisco R Fields, Francis J Castellino, Giorgia Manzo, Henry M Vu, Ilona P Foik, Jeshina Janardhanan, Jessica N Ross, J Mark M Sutton, Mayland Chang, Melanie Clifford, Phoebe Do D Carmo Silva, Rashna D Balsara, Shaun Lee, Tam T Bui, Veronica R Kalwajtys, Victoria A Ploplis |
| 34345 | 2019-12-06 | Chemical Shifts: 1 set |
NMR Structure of Big-defensin 1 [44-93] from oyster Crassostrea gigas |
The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets.
|
A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne |
| 34346 | 2019-12-06 | Chemical Shifts: 1 set |
NMR Structure of Big-defensin 1 from oyster Crassostrea gigas |
The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets.
|
A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne |
| 27690 | 2019-03-28 | Chemical Shifts: 1 set |
MtFKBP |
Backbone and side chain 1H, 15N and 13C assignments of a putative peptidyl prolyl cis-trans isomerase FKBP12 from Mycobacterium tuberculosis
|
Cristiane D Anobom, Danielle MP Oliveira, Fabio CL Almeida, Guilherme C Andrade, Jose RM Pires, Luis FC Silva |
| 30527 | 2019-06-07 | Chemical Shifts: 1 set |
De novo Designed Protein Foldit3 |
De novo protein design by citizen scientists.
|
Aaron Bauer, Alexander Boykov, Alex Ford, Brian Koepnick, Daniel-Adriano A Silva, David Baker, Firas Khatib, Foldit Players, Frank DiMaio, Gaetano T Montelione, Gaohua Liu, Jeff Flatten, Linda Wei, Matthew J Bick, Roger D Estep, Seth Cooper, Susan Kleinfelter, Tamir Husain, Toke Norgard-Solano, Yojiro Ishida, Zoran Popovic |
| 30446 | 2018-06-26 | Chemical Shifts: 1 set |
HRFLRH peptide NMR structure |
A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities
|
A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates |
| 30449 | 2018-06-26 | Chemical Shifts: 1 set |
HRFLRH peptide NMR structure in the presence of Zn(II) |
A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities
|
A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates |
| 30448 | 2018-06-26 | Chemical Shifts: 1 set |
HRFLRH peptide NMR structure in the presence of CO2 |
A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities
|
A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates |
| 30447 | 2018-06-26 | Chemical Shifts: 1 set |
HRFLRH peptide NMR structure in the presence of Cd(II) |
A Previously Undescribed Hexapeptide His-Arg-Phe-Leu-Arg-His-NH2 From Amphibian Skin Secretion shows CO2 and Metal Biding Affinities
|
A Lopez-Castillo, C Bloch Jr, C J Nascimento, D AT Pires, L MR Arake, L P Silva, M V Prates |
| 30396 | 2018-02-02 | Chemical Shifts: 1 set Spectral_peak_list: 4 sets |
The clavanin peptide in the presence of TFE (2,2,2-trifluoroethanol), presented a amphipathic alpha-helices from Phe-2 to Val-22 residues |
Structural Studies of a Lipid-Binding Peptide from Tunicate Hemocytes with Anti-Biofilm Activity.
|
A L Oliveira, A S Veiga, C A Andrade, C de la Fuente-Nunez, D Gaspar, E S Alves, I C Fensterseifer, J M Nascimento, J R Correa, L M Liao, M A Castanho, O L Franco, O N Silva, R E Hancock, S Korpole, S M Mandal, S M Ribeiro, W F Porto |
| 30368 | 2018-03-14 | Chemical Shifts: 1 set |
Solution NMR structure of Brd3 ET domain bound to Brg1 peptide |
The BRD3 ET domain recognizes a short peptide motif through a mechanism that is conserved across chromatin remodelers and transcriptional regulators
|
Amy E Campbell, Ana Silva, Ann H Kwan, Bin Lu, Cherry Kwong, Christopher R Vakoc, Dorothy Wai, Gerd A Blobel, James D Chalmers, Jason Low, Joel P Mackay, Lorna E Wilkinson-White, Roland Gamsjaeger, Taylor N Szyszka, Wayne M Patrick |
| 30367 | 2018-03-14 | Chemical Shifts: 1 set Spectral_peak_list: 3 sets |
Solution NMR structures of the BRD3 ET domain in complex with a CHD4 peptide |
The BRD3 ET domain recognizes a short peptide motif through a mechanism that is conserved across chromatin remodelers and transcriptional regulators
|
Amy E Campbell, Ana Silva, Ann H Kwan, Bin Lu, Cherry Kwong, Christopher R Vakoc, Dorothy Wai, Gerd A Blobel, James D Chalmers, Jason Low, Joel P Mackay, Lorna E Wilkinson-White, Roland Gamsjaeger, Taylor N Szyszka, Wayne M Patrick |
| 30364 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design7.2 |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30365 | 2018-01-05 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design7.3a |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30366 | 2018-01-05 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design7.3a |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30362 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design12_ss |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30361 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design11_ss |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30360 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design10.2 |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30359 | 2018-01-05 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design10.1 |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30358 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design9.1 |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30357 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design8.2 |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30363 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design14_ss |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30356 | 2017-12-26 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle design7.1 |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30355 | 2018-01-02 | Chemical Shifts: 1 set |
Solution structure of de novo macrocycle Design8.1 |
Comprehensive computational design of ordered peptide macrocycles.
|
D A Silva, D Baker, D E Kim, F Pardo-Avila, G Bhardwaj, G Varani, I K Webb, J N Adkins, J R Cort, M D Shortridge, P Hosseinzadeh, S A Rettie, T W Craven, V K Mulligan, Y M Ibrahim |
| 30058 | 2017-05-04 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 30055 | 2017-04-06 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 30056 | 2017-04-06 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 30045 | 2017-03-30 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 19572 | 2014-10-27 | Chemical Shifts: 1 set |
Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. |
In preparation
|
Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon |
| 19571 | 2014-10-20 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 19158 | 2014-04-16 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions |
DNA quadruplex folding formalism--a tutorial on quadruplex topologies.
|
Andreas Ioannis Karsisiotis, Christopher Webba da Silva |
| 19159 | 2014-04-16 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions |
DNA quadruplex folding formalism--a tutorial on quadruplex topologies.
|
Andreas Ioannis Karsisiotis, Christopher Webba da Silva |
| 16261 | 2009-07-22 | Chemical Shifts: 1 set |
1H, 15N, 13C assignments of the Riphicephalus (Boophilus) microplus antimicrobial protein microplusin |
(1)H, (15)N and (13)C assignments of the Rhipicephalus (Boophilus) microplus anti-microbial peptide microplusin.
|
Carlos A Rezende, Fernanda D Silva, Jose R Pires, Sirlei Daffre |
| 16198 | 2010-11-19 | Chemical Shifts: 1 set |
1H, 13C and 15N backbone and side chain chemical shift assignments of N-terminal domain of Tim23. |
1H.13C and 15N backbone and side-chain resonance assignments of N-terminal domain of a mitochondrial inner membrane translocase (TIM23) from S. cerevisiae
|
Anushikha Thakur, Chittoor Balasubramanyam, Hanudatta S Atreya, Patrick D Silva |
| 6412 | 2005-10-20 | Chemical Shifts: 1 set Coupling Constants: 1 set |
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY |
The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus.
|
Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez |
| 6414 | 2008-07-17 | Chemical Shifts: 1 set |
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY |
The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus.
|
Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez |
| 6411 | 2008-07-16 | Chemical Shifts: 1 set |
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY |
The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus.
|
Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez |
| 6413 | 2005-10-20 | Chemical Shifts: 1 set Coupling Constants: 1 set |
FRAGMENT 33-61 OF BOVINE alpha-HEMOGLBIN: THE EFFECT OF C-TERMINAL AMIDATION AND IDENTIFICATION OF THE MINIMAL PORTION WITH ANTIFUNGAL ACTIVITY |
The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus.
|
Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez |
| 6360 | Unknown | Chemical Shifts: 1 set |
IDENTIFICATION OF MINIMAL PEPTIDE SEQUENCE IN THE AMIDATED FRAGMENT 33-61 OF BOVINE a-HEMOGLBIN |
The micelle-bound structure of an antimicrobial peptide derived from the alpha-chain of bovine hemoglobin isolated from the tick Boophilus microplus.
|
Alberto Spisni, Alessandra Machado, Antonio Miranda, Fernanda D Silva, Mauricio L Sforca, M Teresa Miranda, Rita C Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez |
| 6048 | Unknown | Chemical Shifts: 1 set Coupling Constants: 1 set |
NEW STRUCTURAL FAMILY OF AN ANTIMICROBIAL PEPTIDE DERIVED FROM BOVINE HEMOGLOBIN |
The Micelle-Bound Structure of an Antimicrobial Peptide Derived from the alpha-Chain of Bovine Hemoglobin Isolated from the Tick Boophilus microplus.
|
Alberto Spisni, Alessandra Machado, Antonio Miranda, F D Silva, Maria TM Miranda, Mauricio L Sforca, Rita CR Figueredo, Sergio Oyama, Sirlei Daffre, Thelma A Pertinhez |