Instant search results.
These results are sorted by relevance. You can sort the results by clicking on the table headers.
Download citations for all displayed entries in BibTeX format| Entry ID | Original Release date | Data summary | Entry Title | Citation Title(s) | Authors |
|---|---|---|---|---|---|
| 26973 | 2017-03-28 | Chemical Shifts: 1 set |
Near-complete backbone resonance assignments of acid-denatured human cytochrome c in DMSO: a prelude to studying interactions with phospholipids |
Near-complete backbone resonance assignments of acid-denatured human cytochrome c in dimethylsulfoxide: a prelude to studying interactions with phospholipids
|
Andreas Ioannis Karsisiotis, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
| 30058 | 2017-05-04 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 30055 | 2017-04-06 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 30056 | 2017-04-06 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 30045 | 2017-03-30 | Chemical Shifts: 1 set |
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 25422 | 2015-10-07 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferric form of the G41S mutant of Human Cytochrome c |
Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states
|
Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
| 25420 | 2015-10-07 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferrous form of the G41S mutant of Human Cytochrome c |
Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states
|
Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
| 25418 | 2015-10-07 | Chemical Shifts: 1 set |
Human Cytochrome c WT ferric form (oxidized) |
Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states
|
Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein |
| 19572 | 2014-10-27 | Chemical Shifts: 1 set |
Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. |
In preparation
|
Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon |
| 19571 | 2014-10-20 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. |
Encoding canonical DNA quadruplex structure.
|
Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin |
| 19158 | 2014-04-16 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions |
DNA quadruplex folding formalism--a tutorial on quadruplex topologies.
|
Andreas Ioannis Karsisiotis, Christopher Webba da Silva |
| 19159 | 2014-04-16 | Chemical Shifts: 2 sets |
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions |
DNA quadruplex folding formalism--a tutorial on quadruplex topologies.
|
Andreas Ioannis Karsisiotis, Christopher Webba da Silva |
| 19048 | 2013-08-14 | Chemical Shifts: 2 sets |
Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid |
Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid
|
Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon CK Roberts |
| 19047 | 2013-08-14 | Chemical Shifts: 2 sets |
Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII |
1: Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid 2: Complete 1H, 15N and 13C Resonance Assignments of the 25 kDa Bacillus cereus Metallo-Beta-Lactamase BcII and its Complex with the Broad Spectrum Inhibitor R-Thiomandelic Acid
|
Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon C Roberts |
| 18204 | 2012-03-02 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PEBP1 |
Ligand binding study of human PEBP1/RKIP: interaction with nucleotides and Raf-1 peptides evidenced by NMR and mass spectrometry.
|
Agnes F Delmas, Alain Brans, Andreas I Karsisiotis, Christian Damblon, Fabienne Saab, Francoise Schoentgen, Laurence Jouvensal, Laurette Tavel, Lucie Jaquillard, Martine Cadene |