Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Download citations for all displayed entries in BibTeX format
Entry ID Original Release date Data summary Entry Title Citation Title(s) Authors
26973 2017-03-28 Chemical Shifts: 1 set
Near-complete backbone resonance assignments of acid-denatured human cytochrome c in DMSO: a prelude to studying interactions with phospholipids Near-complete backbone resonance assignments of acid-denatured human cytochrome c in dimethylsulfoxide: a prelude to studying interactions with phospholipids Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
30058 2017-05-04 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30056 2017-04-06 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30055 2017-04-06 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30045 2017-03-30 Chemical Shifts: 1 set
DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
25422 2015-10-07 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferric form of the G41S mutant of Human Cytochrome c Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
25420 2015-10-07 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferrous form of the G41S mutant of Human Cytochrome c Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
25418 2015-10-07 Chemical Shifts: 1 set
Human Cytochrome c WT ferric form (oxidized) Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
19572 2014-10-27 Chemical Shifts: 1 set
Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions. In preparation Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon
19571 2014-10-20 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions. Encoding canonical DNA quadruplex structure. Download bibtex for citation iamge Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
19158 2014-04-16 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions DNA quadruplex folding formalism--a tutorial on quadruplex topologies. Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19159 2014-04-16 Chemical Shifts: 2 sets
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions DNA quadruplex folding formalism--a tutorial on quadruplex topologies. Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19048 2013-08-14 Chemical Shifts: 2 sets
Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid Download bibtex for citation iamge Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon CK Roberts
19047 2013-08-14 Chemical Shifts: 2 sets
Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII 1: Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid
2: Complete 1H, 15N and 13C Resonance Assignments of the 25 kDa Bacillus cereus Metallo-Beta-Lactamase BcII and its Complex with the Broad Spectrum Inhibitor R-Thiomandelic Acid
Download bibtex for citation iamge
Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon C Roberts
18204 2012-03-02 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N Chemical Shift Assignments for human PEBP1 Ligand binding study of human PEBP1/RKIP: interaction with nucleotides and Raf-1 peptides evidenced by NMR and mass spectrometry. Download bibtex for citation iamge Agnes F Delmas, Alain Brans, Andreas I Karsisiotis, Christian Damblon, Fabienne Saab, Francoise Schoentgen, Laurence Jouvensal, Laurette Tavel, Lucie Jaquillard, Martine Cadene