Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Entry ID	Original Release date	Data summary	Entry Title	Citation Title(s)	Authors
26973	2017-03-28	Chemical Shifts: 1 set	Near-complete backbone resonance assignments of acid-denatured human cytochrome c in DMSO: a prelude to studying interactions with phospholipids	Near-complete backbone resonance assignments of acid-denatured human cytochrome c in dimethylsulfoxide: a prelude to studying interactions with phospholipids	Andreas Ioannis Karsisiotis, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
25422	2015-10-07	Chemical Shifts: 1 set	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferric form of the G41S mutant of Human Cytochrome c	Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states	Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
25420	2015-10-07	Chemical Shifts: 1 set	Backbone 1H, 13C, and 15N Chemical Shift Assignments for the ferrous form of the G41S mutant of Human Cytochrome c	Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states	Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
25418	2015-10-07	Chemical Shifts: 1 set	Human Cytochrome c WT ferric form (oxidized)	Backbone resonance assignments of ferric human cytochrome c and the pro-apoptotic G41S mutant in the ferric and ferrous states	Andreas Ioannis Karsisiotis, Badri S Rajagopal, Colin Macdonald, Geoffrey R Moore, Jonathan AR Worrall, Oliver M Deacon, Tharin MA Blumenschein
19572	2014-10-27	Chemical Shifts: 1 set	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.	In preparation	Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon
19159	2014-04-16	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions	DNA quadruplex folding formalism--a tutorial on quadruplex topologies.	Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19158	2014-04-16	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions	DNA quadruplex folding formalism--a tutorial on quadruplex topologies.	Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19048	2013-08-14	Chemical Shifts: 2 sets	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII in Complex with R-Thiomandelic Acid	Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid	Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon CK Roberts
19047	2013-08-14	Chemical Shifts: 2 sets	Solution Structure of the Bacillus cereus Metallo-Beta-Lactamase BcII	1: Complete 1H, 15N and 13C resonance assignments of Bacillus cereus metallo-beta-lactamase and its complex with the inhibitor R-thiomandelic acid 2: Complete 1H, 15N and 13C Resonance Assignments of the 25 kDa Bacillus cereus Metallo-Beta-Lactamase BcII and its Complex with the Broad Spectrum Inhibitor R-Thiomandelic Acid	Andreas Ioannis Karsisiotis, Christian F Damblon, Gordon C Roberts