BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 36116

Title: The structure of a chair-type G-quadruplex of the human telomeric variant in K+ solution   PubMed: 30713633

Authors: Liu, C.; Zhou, B.; Kuryavyi, V.; Zhu, G.

Citation: Liu, Changdong; Zhou, Bo; Geng, Yanyan; Yan Tam, Dick; Feng, Rui; Miao, Haitao; Xu, Naining; Shi, Xiao; You, Yingying; Hong, Yuning; Tang, Ben Zhong; Kwan Lo, Pik; Kuryavyi, Vitaly; Zhu, Guang. "A chair-type G-quadruplex structure formed by a human telomeric variant DNA in K"  Chem. Sci. 10, 218-226 (2019).

Assembly members:
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'), polymer, 21 residues, 6661.276 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3'): GGGTTAGGGTTAGGGTTTGG G

Data sets:
Data typeCount
1H chemical shifts175

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 21 residues - 6661.276 Da.

1   DGDGDGDTDTDADGDGDGDT
2   DTDADGDGDGDTDTDTDGDG
3   DG

Samples:

sample_1: DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') 2.5 mM; Potassium Phosphate 20 mM; KCl 70 mM; H2O 90%; D2O, [U-2H], 10%

sample_2: DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3') 2.5 mM; Potassium Phosphate 20 mM; KCl 70 mM; D2O, [U-2H], 100%

sample_conditions_1: ionic strength: 90 mM; pH: 7; pressure: 1 atm; temperature: 284 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-1H COSYsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - chemical shift calculation

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

VNMR, Varian - collection

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

NMR spectrometers:

  • Varian INOVA 800 MHz
  • Varian INOVA 500 MHz

Related Database Links: