BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34302

Title: The major G-quadruplex form of HIV-1 LTR   PubMed: 30299955

Authors: Phan, A.; Heddi, B.; Butovskaya, E.; Bakalar, B.; Richter, S.

Citation: Butovskaya, E.; Heddi, B.; Bakalar, B.; Richter, S.; Phan, A.. "Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop"  J. Am. Chem. Soc. ., .-. (2018).

Assembly members:
entity_1, polymer, 28 residues, 8865.647 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGAGGCGTGGCCTGGGCGG GACTGGGG

Data sets:
Data typeCount
1H chemical shifts229

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 28 residues - 8865.647 Da.

1   DGDGDGDADGDGDCDGDTDG
2   DGDCDCDTDGDGDGDCDGDG
3   DGDADCDTDGDGDGDG

Samples:

sample_1: potassium chloride, NA, 70 mM; potassium phosphate, NA, 20 mM; DNA (28-MER) 1 mM

sample_conditions_1: ionic strength: 90 mM; pH: 7.0; pressure: 1 Pa; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HMBCsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

SPARKY, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker AvanceII 600 MHz
  • Bruker AvanceII 700 MHz

Related Database Links: