BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34297

Title: Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex   PubMed: 30222243

Authors: Lenarcic Zivkovic, M.; Rozman, J.; Plavec, J.

Citation: Plavec, J.; Lenarcic Zivkovic, M.; Rozman, J.. "Adenine-driven structural switch from two- to three-quartet DNA G-quadruplex."  Angew. Chem. Int. Ed. Engl. ., .-. (2018).

Assembly members:
entity_1, polymer, 20 residues, 6410.127 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGTAGGGAGCGGGAGAGGG

Data sets:
Data typeCount
1H chemical shifts156

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 20 residues - 6410.127 Da.

1   DGDGDGDTDADGDGDGDADG
2   DCDGDGDGDADGDADGDGDG

Samples:

sample_1: DNA (5'-D(*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*AP*GP*GP*G)-3') 0.6 mM

sample_2: DNA (5'-D(*GP*GP*GP*TP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*AP*GP*GP*G)-3') 0.8 mM

sample_conditions_1: ionic strength: 100 mM; pH: 7.0; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation

NMR spectrometers:

  • Agilent DD2 600 MHz
  • Varian INOVA 800 MHz

Related Database Links: