BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34210

Title: 2'F-araG modified quadruplex with flipped G-tract and central tetrad   PubMed: 29460996

Authors: Dickerhoff, J.; Weisz, K.

Citation: Dickerhoff, J.; Weisz, K.. "Fluorine-Mediated Editing of a G-Quadruplex Folding Pathway."  Chembiochem ., .-. (2018).

Assembly members:
entity_1, polymer, 22 residues, 6990.482 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGATGGGACACAGGGGACG GG

Data sets:
Data typeCount
13C chemical shifts24
1H chemical shifts143

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 22 residues - 6990.482 Da.

1   DGDGDGDADTDGDGDGDADC
2   DADCDADGGFLDGDGDADCDG
3   DGDG

Samples:

sample_1: DNA 0.37 mM; potassium phosphate 10 mM

sample_2: DNA 0.37 mM; potassium phosphate 10 mM

sample_conditions_1: ionic strength: 10 mM; pH: 7; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_1isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation

AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

Analysis, CCPN - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links: