BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34145

Title: G-quadruplex of Human papillomavirus type 52

Authors: Marusic, M.; Plavec, J.

Citation: Marusic, M.; Plavec, J.. "G-quadruplex of Human papillomavirus type 52"  . ., .-..

Assembly members:
entity_1, polymer, 23 residues, 7276.684 Da.

Natural source:   Common Name: Human papillomavirus type 52   Taxonomy ID: 10618   Superkingdom: Viruses   Kingdom: not available   Genus/species: Alphapapillomavirus Alphapapillomavirus 9

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGGTAGGGCAGGGGACACAG GGT

Data sets:
Data typeCount
13C chemical shifts27
1H chemical shifts221

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 23 residues - 7276.684 Da.

1   DGDGDGDTDADGDGDGDCDA
2   DGDGDGDGDADCDADCDADG
3   DGDGDT

Samples:

sample_1: entity_1 1.2 ± 0.1 mM; potassium phosphate 10 ± 0.5 mM; potassium chloride 40 ± 0.5 mM

sample_2: entity_1 1.2 ± 0.1 mM; potassium phosphate 10 ± 0.5 mM; potassium chloride 40 ± 0.5 mM

sample_3: entity_1, 15N site-specifically labelled at 5%, 0.9 ± 0.1 mM; potassium phosphate 10 ± 0.5 mM; potassium chloride 40 ± 0.5 mM

sample_conditions_1: ionic strength: 50 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1
2D HP COSYsample_2isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_3isotropicsample_conditions_1

Software:

vnmrj v3., Agilent - collection

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY v3.115, Goddard - chemical shift assignment, data analysis, peak picking

AMBER v14, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation

NMR spectrometers:

  • Varian VNMRS 800 MHz
  • Varian DD2 600 MHz

Related Database Links: