BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34086

Title: Solution structure of a human G-Quadruplex hybrid-2 form in complex with a Gold-ligand   PubMed: 28524432

Authors: Wirmer-Bartoschek, J.; Jonker, H.; Bendel, L.; Gruen, T.; Bazzicalupi, C.; Messori, L.; Gratteri, P.; Schwalbe, H.

Citation: Wirmer-Bartoschek, J.; Bendel, L.; Jonker, H.; Grun, J.; Papi, F.; Bazzicalupi, C.; Messori, L.; Gratteri, P.; Schwalbe, H.. "Solution NMR Structure of a Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements that Affect Ligand Binding."  Angew. Chem. Int. Ed. Engl. 56, 7102-7106 (2017).

Assembly members:
entity_1, polymer, 26 residues, 8200.269 Da.
entity_K, non-polymer, 39.098 Da.
entity_AUZ, non-polymer, 794.406 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TTAGGGTTAGGGTTAGGGTT AGGGTT

Data sets:
Data typeCount
1H chemical shifts274

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_2, 12
3entity_2, 22
4entity_33

Entities:

Entity 1, entity_1 26 residues - 8200.269 Da.

1   DTDTDADGDGDGDTDTDADG
2   DGDGDTDTDADGDGDGDTDT
3   DADGDGDGDTDT

Entity 2, entity_2, 1 - K - 39.098 Da.

1   K

Entity 3, entity_3 - C24 H24 Au2 N4 O2 - 794.406 Da.

1   AUZ

Samples:

sample_1: Auoxo6 1.3 mM; DNA 26mer 1 mM; DSS 0.3 mM; KPi 25 mM; potassium chloride 70 mM

sample_2: Auoxo6 1.3 mM; DNA 26mer 1 mM; DSS 0.3 mM; KPi 25 mM; potassium chloride 70 mM

sample_conditions_1: ionic strength: 95 mM; pH: 7; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 95 mM; pH: 7; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYsample_1isotropicsample_conditions_1
2D NOESYsample_2isotropicsample_conditions_2
2D COSYsample_1isotropicsample_conditions_1
2D COSYsample_2isotropicsample_conditions_2
2D 1H-13C HSQC aliphaticsample_2isotropicsample_conditions_2
2D 1H-13C HSQC aromaticsample_2isotropicsample_conditions_2

Software:

ARIA v1.2 HJ development version, Linge, O'Donoghue and Nilges - refinement, structure calculation

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - structure calculation

SPARKY v3.114, Goddard and Kneller - chemical shift assignment, data analysis, peak picking

TOPSPIN v3.2, Bruker Biospin - collection, processing

NMR spectrometers:

  • Bruker AVIII 600 MHz
  • Bruker AV700 700 MHz

Related Database Links: