BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30402

Title: Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine   PubMed: 29888501

Authors: Lin, C.; Yang, D.

Citation: Lin, C.; Wu, G.; Wang, K.; Onel, B.; Sakai, S.; Shao, Y.; Yang, D.. "Molecular Recognition of the Hybrid-2 Human Telomeric G-quadruplex by Epiberberine: Insights into Conversion of Telomeric G-quadruplex Structures."  Angew. Chem. Int. Ed. Engl. 57, 10888-10893 (2018).

Assembly members:
entity_1, polymer, 26 residues, 8200.269 Da.
entity_EWV, non-polymer, 336.361 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: TTAGGGTTAGGGTTAGGGTT AGGGTT

Data sets:
Data typeCount
1H chemical shifts285

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2entity_22

Entities:

Entity 1, entity_1 26 residues - 8200.269 Da.

1   DTDTDADGDGDGDTDTDADG
2   DGDGDTDTDADGDGDGDTDT
3   DADGDGDGDTDT

Entity 2, entity_2 - C20 H18 N O4 - 336.361 Da.

1   EWV

Samples:

sample_1: DNA (26-MER) 880 uM; epiberberine 880 uM

sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1anisotropicsample_conditions_1
2D 1H-1H TOCSYsample_1anisotropicsample_conditions_1
2D 1H-1H NOESYsample_1anisotropicsample_conditions_2

Software:

SPARKY, Goddard - chemical shift assignment, peak picking

InsightII, Accelrys Software Inc. - structure calculation

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMR spectrometers:

  • Bruker Avance 600 MHz

Related Database Links: