BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30058

Title: DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium   PubMed: 30182059

Authors: Dvorkin, S.; Karsisiotis, A.; Webba da Silva, M.

Citation: Dvorkin, Scarlett; Karsisiotis, Andreas; Webba da Silva, Mateus. "Encoding canonical DNA quadruplex structure."  Sci Adv 4, eaat3007-eaat3007 (2018).

Assembly members:
DNA (25-MER), polymer, 25 residues, 7978.100 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32644   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA (25-MER): GGGGTTTGGGGTTTTGGGGA AGGGG

Data sets:
Data typeCount
1H chemical shifts256

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 25 residues - 7978.100 Da.

1   DGDGDGDGDTDTDTDGDGDG
2   DGDTDTDTDTDGDGDGDGDA
3   DADGDGDGDG

Samples:

sample_1: DNA (25-MER), none, 2 ± 0.2 mM; NaPi 20 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 293.15 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-31P HSQCsample_1isotropicsample_conditions_1

Software:

Felix, Accelrys Software Inc. - chemical shift assignment

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation

NMR spectrometers:

  • Varian VNMRS 500 MHz
  • Bruker AvanceIII 900 MHz

Related Database Links: