BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30012

Title: NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region   PubMed: 28330874

Authors: Salgado, G.; Kerkour, A.; Mergny, J.-L.

Citation: Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya; Mergny, Jean-Louis; Salgado, Gilmar. "High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation"  J. Biol. Chem. 292, 8082-8091 (2017).

Assembly members:
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3'), polymer, 22 residues, 6986.514 Da.
POTASSIUM ION, non-polymer, 39.098 Da.

Natural source:   Common Name: human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: homo not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3'): AGGGCGGTGTGGGAATAGGG AA

Data sets:
Data typeCount
1H chemical shifts218

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all