BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27144

Title: DNA with compounds

Authors: Chen, Xiang; Walters, Kylie

Citation: Chen, Xiang; Walters, Kylie. "DNA with compounds"  Nat. Commun. 9, .-. (2018).

Assembly members:
c-Myc_Pu22, polymer, 22 residues, Formula weight is not available
4-[(azepan-1-yl)methyl]-5-hydroxy-2-methyl-N-[4-(trifluoromethyl)phenyl]-1-benzofuran-3-carboxamide, non-polymer, 446.462 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: obtained from a collaborator   Host organism: N/A

Entity Sequences (FASTA):
c-Myc_Pu22: TGAGGGTGGGTAGGGTGGGT AA

Data sets:
Data typeCount
1H chemical shifts207

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1c-Myc Pu221
2DC34, 12
3DC34, 22

Entities:

Entity 1, c-Myc Pu22 22 residues - Formula weight is not available

22 nt of DNA with two compounds

1   DTDGDADGDGDGDTDGDGDG
2   DTDADGDGDGDTDGDGDGDT
3   DADA

Entity 2, DC34, 1 - C24 H25 F3 N2 O3 - 446.462 Da.

1   9WP

Samples:

sample_1: c-Myc Pu22 0.3 mM; Tris, D11, 25 mM; potassium chloride 50 mM

sample_2: c-Myc Pu22 .125 mM; DC34 .25 mM; Tris, D11, 25 mM; potassium chloride 50 mM

sample_3: c-Myc Pu22 .25 mM; DC34 .5 mM; Tris, D11, 25 mM; potassium chloride 50 mM

sample_4: c-Myc Pu22 .25 mM; DC34, selective 13C-labeling, .5 mM; Tris, D11, 25 mM; potassium chloride 50 mM

sample_5: DC34 0.5 mM; Tris, D11, 25 mM; potassium chloride 50 mM

sample_6: c-Myc Pu22 .1 mM; DC340 – .6 mM; Tris, D11, 25 mM; potassium chloride 50 mM

sample_conditions_1: ionic strength: 50 mM; pH: 6.4; pressure: 1 atm; temperature: 298.2 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
2D 1H-1H COSYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_3isotropicsample_conditions_1
2D 1H-1H COSYsample_3isotropicsample_conditions_1
3D 13C half-filtered NOESYsample_4isotropicsample_conditions_1
2D 1H-1H COSYsample_5isotropicsample_conditions_1
2D 1H-1H TOCSYsample_5isotropicsample_conditions_1
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
2D 1H-13C HSQCsample_5isotropicsample_conditions_1
2D 1H-13C HMBCsample_5isotropicsample_conditions_1
1D 1Hsample_6isotropicsample_conditions_1

Software:

TOPSPIN v3.5pl5, Bruker Biospin - collection

NMRPipe v8.9, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

XEASY, Bartels et al. - chemical shift assignment, data analysis, peak picking

MestReNova v11.0, Mestrelab Research - data analysis

NMR spectrometers:

  • Bruker Avance 850 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 700 MHz

Related Database Links: