BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 27053

Title: NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region   PubMed: 28330874

Authors: Salgado, Gilmar; Marquevielle, Julien; Kerkour, Abdelaziz; Mergny, Jean-Louis

Citation: Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya; Mergny, Jean-Louis; Salgado, Gilmar. "High-resolution 3D NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation"  J. Biol. Chem. 292, 8082-8091 (2017).

Assembly members:
KRAS22RT, polymer, 22 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
KRAS22RT: AGGGCGGTGTGGGAATAGGG AA

Data sets:
Data typeCount
1H chemical shifts218

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1G4 within promoter region1

Entities:

Entity 1, G4 within promoter region 22 residues - Formula weight is not available

1   DADGDGDGDCDGDGDTDGDT
2   DGDGDGDADADTDADGDGDG
3   DADA

Samples:

sample_KRAS22RT: KRAS22RT 2.5 mM; KCl 90 mM; KPi 20 mM

sample_conditions_1: ionic strength: 110 mM; pH: 6.65; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_KRAS22RTisotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 700 MHz

Related Database Links: