BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25686

Title: Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome   PubMed: 27298260

Authors: De Nicola, Beatrice; Lech, Christopher Jacques; Regmi, Sagar; Heddi, Brahim; Richter, Sara; Phan, Anh Tuan

Citation: de Nicola, Beatrice; Lech, Christopher Jacques; Regmi, Sagar; Heddi, Brahim; Richter, Sara; Phan, Anh Tuan. "Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome"  Nucleic Acids Res. 44, 6442-6451 (2016).

Assembly members:
DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3'), polymer, 22 residues, 6945.505 Da.

Natural source:   Common Name: viruses   Taxonomy ID: 12721   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3'): CTGGGCGGGACTGGGGAGTG GT

Data sets:
Data typeCount
1H chemical shifts209

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA (5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3')1

Entities:

Entity 1, DNA (5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3') 22 residues - 6945.505 Da.

1   DCDTDGDGDGDCDGDGDGDA
2   DCDTDGDGDGDGDADGDTDG
3   DGDT

Samples:

sample_1: DNA (5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3')0.1 – 1 mM; K+ 10 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 90 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQC aliphaticsample_1isotropicsample_conditions_1
1D JR-HMQCsample_1isotropicsample_conditions_1

Software:

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

TOPSPIN, Bruker Biospin - collection

X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - geometry optimization, structure solution

AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz

Related Database Links: