BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19594

Title: Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3   PubMed: 24356977

Authors: Chung, Wan Jun; Heddi, Brahim; Hamon, Florian; Teulade-Fichou, Marie-Paule; Phan, Anh Tuan

Citation: Chung, Wan Jun; Heddi, Brahim; Hamon, Florian; Teulade-Fichou, Marie-Paule; Phan, Anh Tuan. "Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3."  Angew. Chem. Int. Ed. Engl. 53, 999-1002 (2014).

Assembly members:
DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*G)-3'), polymer, 24 residues, 7691.996 Da.
entity_PQ3, non-polymer, 550.609 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*GP*AP*AP*GP*G)-3'): TGAGGGTGGTGAGGGTGGGG AAGG

Data sets:
Data typeCount
1H chemical shifts194

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all