Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19159

Title: Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions   PubMed: 23791747

Authors: Karsisiotis, Andreas Ioannis; Webba da Silva, Mateus

Citation: Karsisiotis, Andreas Ioannis; Webba da Silva, Christopher. "DNA quadruplex folding formalism--a tutorial on quadruplex topologies."  Methods 64, 28-35 (2013).

Assembly members:
DNA_(5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3'), polymer, 24 residues, 7673.969 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: obtained from a vendor

Entity Sequences (FASTA):

Data typeCount
1H chemical shifts428
31P chemical shifts22

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all