BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18881

Title: NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid

Authors: Skilandat, Miriam; Sigel, Roland

Citation: Skilandat, Miriam; Sigel, Roland. "Determinants of DNA cleavage site recognition in group II intron retrohoming - Solution structure and metal-ion binding sites of the Sc.ai5gamma RNA:DNA contact"  Not known ., .-..

Assembly members:
RNA_(29-MER), polymer, 29 residues, 9301.611 Da.
DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3'), polymer, 7 residues, 2113.428 Da.

Natural source:   Common Name: Baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota not available

Experimental source:   Production method: cell free synthesis   Host organism: not applicable

Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA GCAUACUCC
DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3'): CAGTGTC

Data sets:
Data typeCount
13C chemical shifts56
15N chemical shifts41
1H chemical shifts288

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (29-MER)1
2DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3')2

Entities:

Entity 1, RNA (29-MER) 29 residues - 9301.611 Da.

1   GGAGUAUGUA
2   UUGGCACUGA
3   GCAUACUCC

Entity 2, DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3') 7 residues - 2113.428 Da.

1   DCDADGDTDGDTDC

Samples:

sample_1: RNA_(29-MER)0.6 – 0.9 mM; DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3')0.7 – 1.0 mM; potassium chloride 110 mM; EDTA 10 uM; D2O 100%

sample_2: RNA_(29-MER)0.6 – 0.9 mM; DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3')0.7 – 1.0 mM; potassium chloride 110 mM; EDTA 10 uM; H2O 90%; D2O 10%

sample_3: RNA_(29-MER), [U-100% 13C; U-100% 15N], 0.6 – 0.9 mM; DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3')0.7 – 1.0 mM; potassium chloride 110 mM; EDTA 10 uM; H2O 90%; D2O 10%

sample_4: RNA_(29-MER)0.5 – 1.0 mM; potassium chloride 10 mM; EDTA 10 uM; D2O 100%

sample_5: RNA_(29-MER), [3, 0.6; 5, 2, ; 5, 3, ; 5, 4, ; 5

sample_6: RNA_(29-MER), [U-100% 13C; U-100% 15N], 0.6 – 0.9 mM; DNA_(5'-D(*CP*AP*GP*TP*GP*TP*C)-3')0.7 – 1.0 mM; potassium chloride 110 mM; EDTA 10 uM; D2O 100%

sample_7: RNA_(29-MER), [U-100% 13C; U-100% 15N], 0.5 – 1.0 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O 10%

sample_8: RNA (29-MER)0.5 – 1.0 mM; potassium chloride 10 mM; EDTA 10 uM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 110 mM; pD: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 110 mM; pH: 6.8; pressure: 1 atm; temperature: 298 K

sample_conditions_3: ionic strength: 110 mM; pH: 6.8; pressure: 1 atm; temperature: 278 K

sample_conditions_4: ionic strength: 110 mM; pH: 6.8; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_5isotropicsample_conditions_1
2D 1H-1H NOESYsample_4isotropicsample_conditions_1
2D 1H-1H TOCSYsample_4isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_2
2D 1H-15N HSQCsample_2isotropicsample_conditions_3
2D 1H-13C HSQC aliphaticsample_6isotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_6isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_4
2D 1H-1H NOESYsample_2isotropicsample_conditions_3
2D 1H-1H NOESYsample_2isotropicsample_conditions_3
2D 1H-13C HSQC aliphaticsample_6anisotropicsample_conditions_1
2D 1H-13C HSQC aromaticsample_6anisotropicsample_conditions_1
1D 31Psample_1isotropicsample_conditions_1
F1, F2 X-filtered 1H-1H NOESYsample_3isotropicsample_conditions_2
F1, F2 X-filtered 1H-1H TOCSYsample_3isotropicsample_conditions_2

Software:

TOPSPIN v3.0, Bruker Biospin - data analysis, processing

SPARKY, Goddard - chemical shift assignment, data analysis, peak picking

DYANA v1.5, Guntert, Braun and Wuthrich - data analysis, structure solution

CNS v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

X-PLOR NIH v2.3, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure solution

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz
  • Bruker Avance 500 MHz

Related Database Links: