BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18690

Title: MOMERIC PIL-E G-QUADRUPLEX DNA FROM NEISSERIA GONORRHOEAE   PubMed: 23085077

Authors: Kuryavyi, V.; Patel, D.

Citation: Kuryavyi, Vitaly; Cahoon, Laty; Seifert, H. Steven; Patel, Dinshaw. "RecA-binding pilE G4 sequence essential for pilin antigenic variation forms monomeric and 5' end-stacked dimeric parallel G-quadruplexes."  Structure 20, 2090-2102 (2012).

Assembly members:
5'-D(*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP_*T)-3'_, polymer, 22 residues, 6999.553 Da.

Natural source:   Common Name: Neisseria Gonorrhoeae   Taxonomy ID: 485   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Neisseria Gonorrhoeae

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
5'-D(*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP_*T)-3'_: TAGGGTGGGTTGGGTGGGGA AT

Data sets:
  • assigned_chemical_shifts
Data typeCount
1H chemical shifts188

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1MOMERIC PIL-E G-QUADRUPLEX DNA1

Entities:

Entity 1, MOMERIC PIL-E G-QUADRUPLEX DNA 22 residues - 6999.553 Da.

1   DTDADGDGDGDTDGDGDGDT
2   DTDGDGDGDTDGDGDGDGDA
3   DADT

Samples:

sample_1: MOMERIC PIL-E G-QUADRUPLEX DNA 0.8-6.0 mM; MOMERIC PIL-E G-QUADRUPLEX DNA, [U-13C; U-15N], 0.8 mM; potassium chloride 100 mM; potassium phosphate 5 mM; D2O 90%

sample_2: MOMERIC PIL-E G-QUADRUPLEX DNA 0.8 mM; potassium chloride 100 mM; potassium phosphate 5 mM; D2O 10%; H2O 90%

sample_conditions_1: ionic strength: 0.105 M; pH: 6.8; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_1
1H-15N JRHMQCsample_1isotropicsample_conditions_1
1H-15N HMBCsample_1isotropicsample_conditions_1

Software:

X-PLOR v3.851, BRUNGER, SCHWIETERS, KUSZEWSKI, TJ - refinement

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Bruker Avance 800 MHz

Related Database Links: