BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18279

Title: human CEB25 minisatellite G-quadruplex   PubMed: 22376028

Authors: Amrane, Samir; Adrian, Michael; Heddi, Brahim; Serero, Alexandre; Nicolas, Alain; Mergny, Jean-Louis; Phan, Anh Tuan

Citation: Amrane, Samir; Adrian, Michael; Heddi, Brahim; Serero, Alexandre; Nicolas, Alain; Mergny, Jean-Louis; Phan, Anh Tuan. "Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite."  J. Am. Chem. Soc. 134, 5807-5816 (2012).

Assembly members:
DNA_(26-MER), polymer, 26 residues, 8275.375 Da.

Natural source:   Common Name: Humans   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(26-MER): AAGGGTGGGTGTAAGTGTGG GTGGGT

Data sets:
Data typeCount
13C chemical shifts56
1H chemical shifts233
31P chemical shifts25

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA (26-MER)1

Entities:

Entity 1, DNA (26-MER) 26 residues - 8275.375 Da.

1   DADADGDGDGDTDGDGDGDT
2   DGDTDADADGDTDGDTDGDG
3   DGDTDGDGDGDT

Samples:

sample_1: DNA (26-MER)0.2 – 2 mM; H2O 90%; D2O 10%

sample_conditions_1: ionic strength: 90 mM; pH: 7.00; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1anisotropicsample_conditions_1
2D 1H-31P-HSQCsample_1isotropicsample_conditions_1
2D 1H-13C-HMBCsample_1isotropicsample_conditions_1

Software:

X-PLOR NIH v2.30, Accelrys Software Inc., Goddard, Schwieters, Kuszewski, Tjandra and Clore - data analysis, data analysis, structure solution

NMR spectrometers:

  • Bruker AMX 400 MHz
  • Bruker AMX 600 MHz
  • Bruker AMX 700 MHz
  • Bruker AMX 800 MHz

Related Database Links: