BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 18209

Title: Solution-state structure of an intramolecular G-quadruplex w th propeller, diagonal and edgewise loops   PubMed: 22532609

Authors: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez

Citation: Marusic, Maja; Sket, Primoz; Bauer, Lubos; Viglasky, Viktor; Plavec, Janez. "Solution-state structure of an intramolecular G-quadruplex with propeller, diagonal and edgewise loops."  Nucleic Acids Res. 40, 6946-6956 (2012).

Assembly members:
DNA_molecule_G3ATG3ACACAG4ACG3, polymer, 22 residues, 6972.544 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_molecule_G3ATG3ACACAG4ACG3: GGGATGGGACACAGGGGACG GG

Data sets:
Data typeCount
1H chemical shifts153

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA_molecule_G3ATG3ACACAG4ACG31

Entities:

Entity 1, DNA_molecule_G3ATG3ACACAG4ACG3 22 residues - 6972.544 Da.

1   DGDGDGDADTDGDGDGDADC
2   DADCDADGDGDGDGDADCDG
3   DGDG

Samples:

sample_1: potassium phosphate 10 mM; potassium chloride 40 mM; H2O 90%; D2O 10%; DNA_molecule_G3ATG3ACACAG4ACG3 1.7 mM

sample_2: potassium phosphate 10 mM; potassium chloride 40 mM; D2O 100%; DNA_molecule_G3ATG3ACACAG4ACG3 2.3 mM

sample_conditions_1: ionic strength: 50 mM; pH: 6.8; pressure: 1 atm; temperature: 273 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1

Software:

VNMRJ, Varian - processing

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment, peak picking

AMBER v9, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - refinement, structure solution

NMR spectrometers:

  • Varian Uniform NMR System 800 MHz

Related Database Links: