BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17655

Title: Structure of Human Telomeric DNA in Crowded Solution

Authors: Heddi, Brahim; Phan, Anh Tuan

Citation: Heddi, Brahim; Phan, Anh Tuan. "Structure of Human Telomeric DNA in Crowded Solution"  J. Am. Chem. Soc. ., .-..

Assembly members:
DNA_(5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')_, polymer, 23 residues, 7287.750 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')_: TAGGGTTAGGGTTAGGGTTA GGG

Data sets:
Data typeCount
1H chemical shifts175

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Human Telomeric DNA1

Entities:

Entity 1, Human Telomeric DNA 23 residues - 7287.750 Da.

1   DTDADGDGDGDTDTDADGDG
2   DGDTDTDADGDGDGDTDTDA
3   DGDGDG

Samples:

sample_1: Human_Telomeric_DNA0.2 – 1 mM; PEG 200 mM; H2O mM

sample_conditions_1: pH: 7.00; pressure: 1 atm; temperature: 310 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1

Software:

X-PLOR NIH v2.26, Schwieters, Kuszewski, Tjandra and Clore - structure solution

AMBER v10.0, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - refinement

NMR spectrometers:

  • Bruker AMX 600 MHz
  • Bruker AMX 700 MHz

Related Database Links: