BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17379

Title: QUI/G-quadruplex complex   PubMed: 21967482

Authors: Dai, Jixun; Carver, Megan; Mathad, Ravi; Yang, Danzhou

Citation: Dai, Jixun; Carver, Megan; Hurley, Laurence; Yang, Danzhou. "Solution structure of a 2:1 quindoline-c-MYC G-quadruplex: insights into G-quadruplex-interactive small molecule drug design."  J. Am. Chem. Soc. 133, 17673-17680 (2011).

Assembly members:
DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')_, polymer, 22 residues, 7008.566 Da.
QUI, non-polymer, 174.156 Da.
K, non-polymer, 39.098 Da.

Natural source:   Common Name: human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')_: TGAGGGTGGGTAGGGTGGGT AA

Data sets:
Data typeCount
1H chemical shifts208

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')1
22-CARBOXYQUINOXALINE_12
32-CARBOXYQUINOXALINE_22
4POTASSIUM ION_13
5POTASSIUM ION_23

Entities:

Entity 1, DNA_(5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3') 22 residues - 7008.566 Da.

1   DTDGDADGDGDGDTDGDGDG
2   DTDADGDGDGDTDGDGDGDT
3   DADA

Entity 2, 2-CARBOXYQUINOXALINE_1 - C9 H6 N2 O2 - 174.156 Da.

1   QUI

Entity 3, POTASSIUM ION_1 - K - 39.098 Da.

1   K

Samples:

sample_1: DNA (5, -D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3')', ; 2, QUI, ; 3, potassium phosphate, ; 4, DSS, ; 5, H2O, ; 6, D2O, ;

sample_conditions_1: ionic strength: 0.01 M; pH: 6; pressure: 1 atm; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H COSYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1

Software:

InsightII v2003, Accelrys Software Inc. - refinement

NMR spectrometers:

  • Bruker DRX 600 MHz

Related Database Links: