BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17129

Title: Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.   PubMed: 22129448

Authors: Herve du Penhoat, Catherine; Hantz, Edith; Missailidis, Sotiris; Piotto, Martial; Cognet, Jean; Baouendi, Meriem

Citation: Baouendi, Meriem; Cognet, Jean; Ferreira, Catia; Missailidis, Sotiris; Coutant, Jerome; Piotto, Martial; Hantz, Edith; Herve du Penhoat, Catherine. "Solution structure of a truncated anti-MUC1 DNA aptamer determined by mesoscale modeling and NMR."  FEBS J. 279, 479-490 (2012).

Assembly members:
25-mer_oligodeoxyribonucleotide, polymer, 25 residues, 8147.2 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
25-mer_oligodeoxyribonucleotide: GCAGTTGATCCTTTGGATAC CCTGG

Data sets:
Data typeCount
13C chemical shifts139
1H chemical shifts254
31P chemical shifts25

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
125-mer DNA1

Entities:

Entity 1, 25-mer DNA 25 residues - 8147.2 Da.

1   DGDCDADGDTDTDGDADTDC
2   DCDTDTDTDGDGDADTDADC
3   DCDCDTDGDG

Samples:

sample_2: 25-mer oligodeoxyribonucleotide 1 mM; sodium chloride 50 mM; sodium phosphate 20 mM; sodium azide 5 uM; H2O 90%; D2O 10%

sample_1: 25-mer oligodeoxyribonucleotide 2 mM; sodium chloride 50 mM; sodium phosphate 20 mM; sodium azide 5 uM; D2O 100%

sample_3: 25-mer oligodeoxyribonucleotide 1 mM; sodium chloride 50 mM; sodium phosphate 20 mM; sodium azide 5 uM; H2O 90%; D2O 10%

sample_conditions_1: pH: 6.5; pressure: 1 atm; temperature: 298 K

sample_conditions_2: pH: 6.5; pressure: 1 atm; temperature: 264.7 K

sample_conditions_3: pH: 6.5; pressure: 1 atm; temperature: 261.1 K

sample_conditions_4: pH: 6.5; pressure: 1 atm; temperature: 278.0 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D DQF-COSYsample_1isotropicsample_conditions_1
2D 1H-31P HCOSYINVsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
watergate 1H-1H NOESYsample_2isotropicsample_conditions_4
watergate 1H-1H TOCSYsample_2isotropicsample_conditions_4
watergate 1H-1H NOESYsample_3isotropicsample_conditions_3
g11 1H-1H NOESYsample_3isotropicsample_conditions_2
watergate 1H-1H TOCSYsample_3isotropicsample_conditions_3
2D 1H-31P HSQC_TOCSYsample_1isotropicsample_conditions_1

Software:

PROSA v6.0.2, Guntert - processing

NMRPipe vPC Linux 2004, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

TOPSPIN v3.0, Bruker Biospin - collection, processing

XEASY v1.2, Bartels et al. - chemical shift assignment

NMR spectrometers:

  • Varian UnityPlus 500 MHz
  • Bruker Avance 500 MHz

Related Database Links: