BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 11438

Title: DNA oligomer containing ethylene cross-linked cyclic 2'-deoxyuridylate dimer   PubMed: 21443191

Authors: Furuita, Kyoko; Murata, Shunpei; Jee, JunGoo; Ichikawa, Satoshi; Matsuda, Akira; Kojima, Chojiro

Citation: Furuita, Kyoko; Murata, Shunpei; Jee, JunGoo; Ichikawa, Satoshi; Matsuda, Akira; Kojima, Chojiro. "Structural Feature of Bent DNA Recognized by HMGB1"  J. Am. Chem. Soc. 133, 5788-5790 (2011).

Assembly members:
Ethylene-DNA, polymer, 28 residues, 111.103 Da.

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Ethylene-DNA: CCTTCATTACATCCGGATGT AATGAAGG

Data sets:
Data typeCount
1H chemical shifts211

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1Ethylene-DNA1

Entities:

Entity 1, Ethylene-DNA 28 residues - 111.103 Da.

1   DCDCDTDTDCDADTDTDADC
2   DADTDCDCDGDGDADTDGDT
3   DADADTDGDADADGDG

Samples:

sample_1: Ethylene-DNA 0.7 mM; sodium phosphate 50 mM; sodium chloride 100 mM; H2O 90%; D2O 10%

sample_2: Ethylene-DNA 0.7 mM; sodium phosphate 50 mM; sodium chloride 100 mM; D2O 100%

sample_conditions_1: pH: 6.8; temperature: 283 K

sample_conditions_2: pH: 6.8; temperature: 303 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_2
2D DQF-COSYsample_1isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_2

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - chemical shift assignment

CNS v1.2, Brunger, Adams, Clore, Gros, Nilges and Read - structure solution

MARDIGRAS, Brandan, A. Borgias, Paul D. Thomas, He Liu and Anil Kumar - structure solution

NMR spectrometers:

  • Bruker Avance 500 MHz
  • Bruker DRX 800 MHz

Related Database Links: