BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25534

Title: RNA structure determination by solid-state NMR spectroscopy   PubMed: 25960310

Authors: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa

Citation: Marchanka, Alexander; Simon, Bernd; Althoff-Ospelt, Gerhard; Carlomagno, Teresa. "RNA structure determination by solid-state NMR spectroscopy"  Nat. Commun. 6, 7024-7024 (2015).

Assembly members:
26mer Box C/D RNA, polymer, 26 residues, 7450.573 Da.

Natural source:   Common Name: E. coli   Taxonomy ID: 562   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Escherichia coli

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
26mer Box C/D RNA: GCUGAGCUCGAAAGAGCAAU GAUGUC

Data sets:
Data typeCount
13C chemical shifts173
15N chemical shifts49
31P chemical shifts9

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity1

Entities:

Entity 1, entity 26 residues - 7450.573 Da.

1   GCUGAGCUCG
2   AAAGAGCAAU
3   GAUGUC

Samples:

sample_1: entity, nucleotide-type-selective [U-99% 13C; U-99% 15N], 20 mg/mL; H2O 100%

sample_conditions_1: pH: 7.5; temperature: 260 K

Experiments:

NameSampleSample stateSample conditions
(13C,15N-TEDOR)-13C,13C PDSDsample_1solidsample_conditions_1
13C-31P TEDORsample_1solidsample_conditions_1
CHHCsample_1solidsample_conditions_1
NHHCsample_1solidsample_conditions_1
CN-TEDORsample_1solidsample_conditions_1

Software:

CNS v1.2 - data analysis

NMR spectrometers:

  • Bruker Avance 700 MHz
  • Bruker Avance 600 MHz

Related Database Links: